ZFIN ID: ZDB-TSCRIPT-090929-7419
Transcript Name: cyfip1-003
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000024595 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000024595|OTTDARG00000019867|ZDB-GENE-030131-8557 cyfip1|no_translation cyfip1-003 LG_none BX322552.6,FP085470.9 Danio rerio protein_coding KNOWN, 510 bp
CTAATAATTCTGACTTTAACTGTATATGAGATTTTATATT
TGTTCATAATAAACTGCTTCATTTTCTTGTTTTTCATGAT
TATTTAGGCCTTGAATTTGGCGTACAGCAGCATATACAGC
CTCTACCGCAACTTTGTGGGACCTCCACATATTAAGGCTA
TTTGCAGACTTCTGGGATACCAGGGAATCGCTGTGGTGAT
GGAGGAGCTGTTAAAAGTTGTCAAAAGCCTGCTTCAAGGC
ACCATCCTTCAGTATGTGAAGACATTGATGGAAGTGATGC
CCAAGATTTGCCGTCTGCCTCGCCATGAGTATGGCTCACC
AGGTATCCTGGAGTTCTTCCACCACCAGCTGAAAGACATT
GTGGAGTACGCTGAGCTGAAGACTGTGTGCTTCCAGAACC
TGAGGGAGGTTGGAAACGCATTGCTCTTCTGCCTTCTGAC
TGAACAGAGCTTGGTGAGAAAACACAACATCTCCATTCAC
ATGATTGAACTTTAAGGTGATTAAAGTGAT

cyfip1 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA cyfip1-003 510
cyfip1-004 (1) 515
mRNA cyfip1-201 (1) 4645
cyfip1-202 (1) 1654
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cyfip1-003 Contained in:
OTHER cyfip1-003 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000024595 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AL927572 (1) 510bp
    CITATIONS (1)