ZFIN ID: ZDB-TSCRIPT-090929-7301
Transcript Name: lrrc40-003
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000024434 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000024434|OTTDARG00000019772|ZDB-GENE-030131-6062 lrrc40|no_translation lrrc40-003 LG_ BX255895.6 Danio rerio protein_coding KNOWN, 916 bp
CAGCCCCCTATTCAATATTCTGATTTTAGTTGGAAATGTG
TCATCACACTGAAATAAAACTCAGCAGCAACTTCTGGTTT
ACACAGACTTTAAAGCATCAGATTATTGGTTAATTAAAAA
GATTTGATTTGAAATGTATTTGTGTGGGTGAATCAATGAT
AGAATTTTATATTGGAGGTAGTTATATTGGACCTGTTTTT
ATTTAAAAATAAAGTAATTAAATAAAATAACTACATTTTG
TTACCATTGTGGAATTTTGCTATGTTTTAAATTGTAGAGC
CACCTAACGGAGGCTTGAAAGAAGAACCAAAAACAGCAAT
GACTTTCCCAAGTCAAGCTAAAATTAATGTACATGCCATT
AAAACGCTGAAAACACTGGACTACAGGTAACCACAAACAT
TTTCATAAGTGACTTTTTAGTATAGAATTTTTCCATGTTT
AATTAAAAAAATAAATCCTGTTTTCTTTAGTGAAAAACAA
GACGCATCGATTCCGGATGATGTGTTTGACGCAGTTGATG
GTAATCCTGTGGCCAATGTGAACTTTAGCAAAAATCAGCT
GACGGCTGTTCCACACAGAATTGTGGATTTAAAGGACACT
CTGGCAGACATTAATCTTGGGTTTAACAAGCTAACGACCA
TTCCGGCGGACTTTTGTCATTTGAAACAGCTGATGCATAT
AGATCTCAGGAACAATTTACTGATCTCACTGCCAATGGAG
CTGGAAGGCTTAATCAAACTGCGGAGTGTTATTTTGTCTT
TTAATAGGTTTAAGTCATTCCCAGAAGTGCTGTACCGAAT
CCCATCTCTAGAAACCATTTTAATCAGCAGCAATCAAGTT
GGAGGCATTGATGCTGTCCAAATGAAGACCTTAAGTAGGC
TGTCAACCCTGGATCTGTCCAACAATGACATCATGC

lrrc40 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA lrrc40-002 (1) 850
lrrc40-003 916
mRNA lrrc40-201 (1) 2217
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
lrrc40-003 Contained in:
OTHER lrrc40-003 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000024434 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CT693389 (1) 916bp
    CITATIONS (1)