ZFIN ID: ZDB-TSCRIPT-090929-7299
Transcript Name: lrrc40-201
Previous Name: lrrc40-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000024432 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000024432|OTTDARG00000019772|ZDB-GENE-030131-6062 lrrc40|OTTDARP00000020167 lrrc40-001 LG_ BX255895.6 Danio rerio protein_coding KNOWN, 2217 bp
TTACAATTGTTTACTTCACAACACTACAACCTCATTCAAG
TATACAGGTGCTTTAACATCGCATTGATGTCTCGTTTTAA
AAGAGGAGCACACGTGGACTCCAGAGCAGGATTCAGACAA
GAGAAGGAAGACTGTCCTGTTCCGTATGGCTTACTGAAAG
CTGCTAGAAAGAGCGGGCAGCTCAATCTGTCCGGGCGCGG
TCTAACCGAAGTTCCTGCTAGTGTATGGAGGTTGAACTTA
GACACACCTCAGGAAGCCAAGCAAAATGTGTCTTTTGGAG
CTGAAGATCGGTGGTGGGAACAGACTGATCTGACCAAACT
GCTTCTGTCCTCCAACAAACTCCAGAGCATCCCTGATGAT
GTTAAACTTCTGCCTGCCCTGGTGGTCCTTGATATCCATG
ACAATCAGCTTAGCTCGCTGCCAGATTCTATTGGAGATCT
AGAGCAGCTACAGAAGCTGATATTGAGTCACAATAAACTG
ACAGAATTGCCTTCGGGTGTCTGGAGACTCACAAACCTGC
GATGTCTCCATCTGCAACAGAATCTCATTGAACAGATTCC
TCGAGATCTAGGGCAGCTGGTTAACTTGGATGACCTTGAT
CTTTCCAACAATCATCTAATAGATATTCCAGAAAGCCTTG
CAAACCTCCAAAATCTTGTGAAGTTGGATTTGTCCTGCAA
CAAGCTCAAGAGTCTTCCTCCTGCCATCAGTCAAATGAAA
AACCTGAGAATGCTGGACTGTTCCCGAAACCAGATGGAGA
GCATTCCTCCTGTCCTGGCTCAGATGGAGTCCCTTGAACA
GCTTTACTTGAGACACAACAAGCTACGCTTTTTGCCTGAA
CTGCCCTGCTGTAAAACACTGAAGGAACTTCATTGTGGAA
ATAACCAGATTGAGGTATTGGAGGCAGAGCATCTGAAGCA
CCTGAACGCTCTGAGTTTGCTGGAGCTCAGAGATAATAAG
GTGAAGAGCCTTCCTGAGGAAATAACCCTACTGCAAGGCC
TGGAGCGCCTGGATCTTACTAACAATGACATCAGCAGTCT
GCCGTGTGGACTTGGCACATTACCCAAACTGAAGTCTTTG
TCCTTGGAAGGCAACCCACTGAGGGCAATCCGCAGAGATC
TCCTGACTAAAGGCACTGGTGAACTCCTAAAATATCTCAG
AAGTCGTGTACAAGAGCCACCTAACGGAGGCTTGAAAGAA
GAACCAAAAACAGCAATGACTTTCCCAAGTCAAGCTAAAA
TTAATGTACATGCCATTAAAACGCTGAAAACACTGGACTA
CAGTGAAAAACAAGACGCATCGATTCCGGATGATGTGTTT
GACGCAGTTGATGGTAATCCTGTGGCCAATGTGAACTTTA
GCAAAAATCAGCTGACGGCTGTTCCACACAGAATTGTGGA
TTTAAAGGACACTCTGGCAGACATTAATCTTGGGTTTAAC
AAGCTAACGACCATTCCGGCGGACTTTTGTCATTTGAAAC
AGCTGATGCATATAGATCTCAGGAACAATTTACTGATCTC
ACTGCCAATGGAGCTGGAAGGCTTAATCAAACTGCGGAGT
GTTATTTTGTCTTTTAATAGGTTTAAGTCATTCCCAGAAG
TGCTGTACCGAATCCCATCTCTAGAAACCATTTTAATCAG
CAGCAATCAAGTTGGAGGCATTGATGCTGTCCAAATGAAG
ACCTTAAGTAGGCTGTCAACCCTGGATCTGTCCAACAATG
ACATCATGCAAGTGCCACCGGAACTCGGCAACTGTACCAG
TCTGAGGGCTCTAATGCTTGATGGGAATCCTTTCCGTAAT
CCAAGAGCTGCCATCCTTATTAAAGGCACAGATGCTGTCC
TTGAGTATCTCCGAAGTCGTATTCCAACATGAAAATGAAA
GACAATTCAGCCGTCTTTGAAAAAAAAAAAAAACTATCAA
TTTGTGTGCCATAACACTTTATTTGCACTTCTTGACCGTA
TATACATATTAAAAAAATGAAAAGACACGATTTATCTTCT
TCCACTTGTTTTAATTAATGAGACCTGCCATTATACCCTT
CAAATAAATAATTATGAATTTTGTACTGATTTCCTTTTGA
AACCAAACGCATGCTTTGTAATAAAATTAAGAGAACAACT
GAACAACAAAAACATGCTTGTTTTAAGTTTTGTAATTGGT
TTTGAACGTTTCAATTTTTCATTACAAAAGCACCAAATAA
ATGATGACATGAAAGAC

lrrc40 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA lrrc40-002 (1) 850
lrrc40-003 (1) 916
mRNA lrrc40-201 2217
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
lrrc40-201 Contained in:
OTHER lrrc40-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000024432 (1)
  • Ensembl_Trans:ENSDART00000022586 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AY394934 (1) 2201bp
    GenBank:BC055223 (1) 1905bp
    GenBank:DV590118 (1) 881bp
    GenBank:CN014517 (1) 855bp
    GenBank:CK695233 (1) 836bp
    GenBank:DN895048 (1) 788bp
    GenBank:CK142000 (1) 757bp
    GenBank:DT871374 (1) 708bp
    GenBank:CT693390 (1) 600bp
    GenBank:AW421002 (1) 570bp
    GenBank:AW170820 (1) 549bp
    GenBank:BI885344 (1) 427bp
    GenBank:DN894535 (1) 373bp
    GenBank:CK699570 (1) 362bp
    CITATIONS (2)