ZFIN ID: ZDB-TSCRIPT-090929-7299
Transcript Name: lrrc40-201
Previous Name: lrrc40-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000024432 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000024432|OTTDARG00000019772|ZDB-GENE-030131-6062 lrrc40|OTTDARP00000020167 lrrc40-001 LG_ BX255895.6 Danio rerio protein_coding KNOWN, 2217 bp
TTACAATTGTTTACTTCACAACACTACAACCTCATTCAAG
TATACAGGTGCTTTAACATCGCATTGATGTCTCGTTTTAA
AAGAGGAGCACACGTGGACTCCAGAGCAGGATTCAGACAA
GAGAAGGAAGACTGTCCTGTTCCGTATGGCTTACTGAAAG
CTGCTAGAAAGAGCGGGCAGCTCAATCTGTCCGGGCGCGG
TCTAACCGAAGTTCCTGCTAGTGTATGGAGGTTGAACTTA
GACACACCTCAGGAAGCCAAGCAAAATGTGTCTTTTGGAG
CTGAAGATCGGTGGTGGGAACAGACTGATCTGACCAAACT
GCTTCTGTCCTCCAACAAACTCCAGAGCATCCCTGATGAT
GTTAAACTTCTGCCTGCCCTGGTGGTCCTTGATATCCATG
ACAATCAGCTTAGCTCGCTGCCAGATTCTATTGGAGATCT
AGAGCAGCTACAGAAGCTGATATTGAGTCACAATAAACTG
ACAGAATTGCCTTCGGGTGTCTGGAGACTCACAAACCTGC
GATGTCTCCATCTGCAACAGAATCTCATTGAACAGATTCC
TCGAGATCTAGGGCAGCTGGTTAACTTGGATGACCTTGAT
CTTTCCAACAATCATCTAATAGATATTCCAGAAAGCCTTG
CAAACCTCCAAAATCTTGTGAAGTTGGATTTGTCCTGCAA
CAAGCTCAAGAGTCTTCCTCCTGCCATCAGTCAAATGAAA
AACCTGAGAATGCTGGACTGTTCCCGAAACCAGATGGAGA
GCATTCCTCCTGTCCTGGCTCAGATGGAGTCCCTTGAACA
GCTTTACTTGAGACACAACAAGCTACGCTTTTTGCCTGAA
CTGCCCTGCTGTAAAACACTGAAGGAACTTCATTGTGGAA
ATAACCAGATTGAGGTATTGGAGGCAGAGCATCTGAAGCA
CCTGAACGCTCTGAGTTTGCTGGAGCTCAGAGATAATAAG
GTGAAGAGCCTTCCTGAGGAAATAACCCTACTGCAAGGCC
TGGAGCGCCTGGATCTTACTAACAATGACATCAGCAGTCT
GCCGTGTGGACTTGGCACATTACCCAAACTGAAGTCTTTG
TCCTTGGAAGGCAACCCACTGAGGGCAATCCGCAGAGATC
TCCTGACTAAAGGCACTGGTGAACTCCTAAAATATCTCAG
AAGTCGTGTACAAGAGCCACCTAACGGAGGCTTGAAAGAA
GAACCAAAAACAGCAATGACTTTCCCAAGTCAAGCTAAAA
TTAATGTACATGCCATTAAAACGCTGAAAACACTGGACTA
CAGTGAAAAACAAGACGCATCGATTCCGGATGATGTGTTT
GACGCAGTTGATGGTAATCCTGTGGCCAATGTGAACTTTA
GCAAAAATCAGCTGACGGCTGTTCCACACAGAATTGTGGA
TTTAAAGGACACTCTGGCAGACATTAATCTTGGGTTTAAC
AAGCTAACGACCATTCCGGCGGACTTTTGTCATTTGAAAC
AGCTGATGCATATAGATCTCAGGAACAATTTACTGATCTC
ACTGCCAATGGAGCTGGAAGGCTTAATCAAACTGCGGAGT
GTTATTTTGTCTTTTAATAGGTTTAAGTCATTCCCAGAAG
TGCTGTACCGAATCCCATCTCTAGAAACCATTTTAATCAG
CAGCAATCAAGTTGGAGGCATTGATGCTGTCCAAATGAAG
ACCTTAAGTAGGCTGTCAACCCTGGATCTGTCCAACAATG
ACATCATGCAAGTGCCACCGGAACTCGGCAACTGTACCAG
TCTGAGGGCTCTAATGCTTGATGGGAATCCTTTCCGTAAT
CCAAGAGCTGCCATCCTTATTAAAGGCACAGATGCTGTCC
TTGAGTATCTCCGAAGTCGTATTCCAACATGAAAATGAAA
GACAATTCAGCCGTCTTTGAAAAAAAAAAAAAACTATCAA
TTTGTGTGCCATAACACTTTATTTGCACTTCTTGACCGTA
TATACATATTAAAAAAATGAAAAGACACGATTTATCTTCT
TCCACTTGTTTTAATTAATGAGACCTGCCATTATACCCTT
CAAATAAATAATTATGAATTTTGTACTGATTTCCTTTTGA
AACCAAACGCATGCTTTGTAATAAAATTAAGAGAACAACT
GAACAACAAAAACATGCTTGTTTTAAGTTTTGTAATTGGT
TTTGAACGTTTCAATTTTTCATTACAAAAGCACCAAATAA
ATGATGACATGAAAGAC

lrrc40 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA lrrc40-201 2217
ncRNA lrrc40-002 (1)    Ensembl 850
lrrc40-003 (1)    Ensembl 916
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
lrrc40-201 Contained in:
[BAC] CH211-241M14 (1)

Genome Resources: Vega_Trans:OTTDART00000024432 (1),  Ensembl_Trans:ENSDART00000022586 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:AY394934 (1) 2201 nt
GenBank:BC055223 (1) 1905 nt
GenBank:DV590118 (1) 881 nt
GenBank:CN014517 (1) 855 nt
GenBank:CK695233 (1) 836 nt
GenBank:DN895048 (1) 788 nt
GenBank:CK142000 (1) 757 nt
GenBank:DT871374 (1) 708 nt
GenBank:CT693390 (1) 600 nt
GenBank:AW421002 (1) 570 nt
GenBank:AW170820 (1) 549 nt
GenBank:BI885344 (1) 427 nt
GenBank:DN894535 (1) 373 nt
GenBank:CK699570 (1) 362 nt
CITATIONS (2)