Transcript

tenm4-204

ID
ZDB-TSCRIPT-090929-73
Name
tenm4-204
Previous Names
  • odz4-001
  • tenm4-001
  • ottdart00000002077
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000002077 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000002077|OTTDARG00000001945|ZDB-GENE-990714-20 tenm4|OTTDARP00000001833 odz4-001 LG_none AL807754.8,CU929551.9,CU928223.11,CU856523.11 Danio rerio protein_coding KNOWN, 9523 bp
AATCTGACGGTCTGAAGCAGCTCTTTTCTCTCTTTCATGC
TGATACTCCAGACGTGTCCGTGATGGAAGTCAAGGAACGC
AGACCCTACCGCTCTCTGACCTCCAGGCGGGACACGGAGC
GCCGCTACACCAGCTCATCCGCCGACAGCGAGGATGGCAA
GATCAACCCTAAATCTTACAGCTCGAGTGAGACCCTCAAA
GCCTTCGACCAGGACTCCAGACTGGCTTATGGCAGCCGCG
TCAAAGACCTGGTGCACCATGAGGCCGACGAGTTCAGCAG
ACAAGGGCCGGACTTTTCTCTCAGAGACATGGCCTTCGGA
GATCCCGTGCCGCCACATATGGCAGCGTACCGGACAGAAA
TGGGCCTTCCCCACCGCGACTACTCAGTGAGTGTGGCATC
AGACGCTGACACAGAAACAGACGGCATAATGTCCCCCGAG
CACGCCGTCCGCCTCTGGGGCCGCAGCAACACCAAATCCG
GCCGCAGTTCCTGCCTGTCCAGCAGAGCCAACTCCAACCT
TACGCTCACCGACACCGAGCATGAAAACACTGAGAATGAG
GGCTCGTTCCAGAATCACTCACGGTTGCGAACGCCACCAT
TACCCCTGTCTCACTCGCACTCCCCCAGTCAGCACCACAC
CGCCTCCATCGGTTCCCTGAGCCGCAGCAACTACACCCAG
CGCAGTAACCCGAGCCCGGCACCCACCGATAGTTCAGCTC
CCAATGAGGGTCCGACAAGTGCCCAGGACTCCAGCAGCGC
CCAGGACAACTGGCTTCTCAACAGCAACGTTCCTCTAGAG
ACCAGAAACATAGCAAAGCAGACATTCCTAGAGACTTTGC
AGGACAACTTTATAGAGATGGACATACTGGCGACAACTCG
CCGCGACGGCGCTTACACTGATGGACACTTTCTTTTCAAG
CCTGGCGGGACCTCGCCTTTGTACTGCACCACTTCACCTG
GTTACCCTTTGACGTCCAGCACGGTGTACTCTCCTCCGCC
CCGGCCCCTGCCAAGAAACACCTTCTCACGGCCTGCCTTT
AGCCTGAAGAAACCCTATAAGCACTGCAACTGGAAATGTG
CTGCCCTCAGTGCCATCCTCATCTCTGTCACCCTGGTGTT
CCTGTTGGCATACTTTATTGCCATGCACCTCTTTGGACTC
AACTGGCATTTGCAGCCGGTGCAGAGGCAGATATATCAGC
TGACGGAGGACAACACCAGTGGCCTACATCTGCCCACAGA
TCTGGGGCTGCCACCTCTGGGTAACACAGGTCTAGAGTTT
CCAGATCGAGGAAGCAGAGACGATGGTAAACTAGATGGCT
TCTTCCCGGAGGACAGCTTCATAGACATGGGCGAGATAGA
CGTGGGCCGCAAAGTGGCTCAGCTGATCCCGCCTGGAATC
TTTTGGAGGTCGCAGGTCTTTATTGATCACCCAATGTACC
TCAAATTCAATGTGTCCCTTAGTAAAGATGCCTTGGTGGG
GATCTACGGGAGGAGAGGACTGCCACCGTCACACACACAG
TTTGACTTTGTGGAGCTGTTGGATGGTCGTCGGCTTCTGT
CGCAAGGCTTGCCAGGTCTTGATGGTCCGCCTTTTCCAGC
CCAGCAGCGGAGCCTGGTGCCTATCACCAGTCATGATACA
GGATTTATACAGTACATGGACTCGGGAATCTGGCACTTGG
CTGTATACAATGATGGGAAGGAGACTGAGCAGGTGTCCTT
TCTAACAACTGCAATCGACTCTATTGATGACTGTCCTAGT
AACTGTTTTGGAAATGGAGACTGTGTGTCTGGAAACTGCC
ATTGTTTTCCAGGCTTCAGAGGACCCGACTGCAGCAGGGC
ATCATGTCCTGTGCTGTGCAGTGGGAACGGTCAGTACCTG
AAAGGACGCTGCATGTGTCACAGCGGCTGGAAAGGGTCTG
AATGTGATGTTCCTACAAACCAGTGCATCGACATCACCTG
CAGTGGACATGGAACATGCATTGTGGGAACCTGCATCTGC
AATCCTGGCTACAAAGGAGAAAACTGCGAAGAAGTGGACT
GTCTGGACCCAACCTGTTCAGGGAGAGGTGTGTGCGTTCG
GGGAGAGTGCCACTGTTTTGTGGGATGGGGAGGTCCTGGA
TGTGAGAGTCCTCGTGCGTCCTGTATGGAGCAGTGCTCTG
GACACGGGAGTTTCTTGGCTGATACAAACACCTGCAACTG
TGACCACAACTGGACCGGTCATGACTGCTCCACAGAGCTG
TGCGCAGCGGACTGTGGTGGACATGGCATCTGTGTGGCGG
GCAGCTGCCGGTGCGACGAGGGCTGGATGGGCACCGGGTG
CGAGCAACGGGCTTGTCACCCTCGCTGCAGCGAACACGGG
ACCTGCAAGGACGGAAAGTGCGAATGCAGCCCGGGATGGA
ATGGAGAACACTGCACTATCGAGGGCTGCCCTGGTCTGTG
CAATGGCAATGGCAGATGCACGCTGGGTAATAATGGCTGG
TACTGCGTTTGTCAACTGGGCTGGCGGGGAGCAGGCTGCG
ACACATCAATGGAGACGGCCTGCAGTGACGGCAAGGACAA
TGATGGAGATGGGTTGACGGACTGCATGGACCCGGATTGC
TGCTTGCAGGCATCATGTCACACAACATCTCTGTGTGTGG
GCTCTCCCGATCCTCTGGATATCATTCAGGAAACCCAAAT
CTCTTCCAGTCTGAGCACCCTGCAGTCCTTCTATCAGCGC
ATCCATTTCTTGGTGGGCCGGGACAGCACCCATGTCATAC
CTGGTGTCAATCCCTTTGATGGCATTCATGCCTGCGTTAT
CCGGGGACAAGTGGTGACTTCTGATGGAACTCCTTTGGTT
GGCGTAAATATCAGCTTCATTAACAAACCGGCCTATGGGT
ATACAATCACCAGACAGGACGGCAGCTTTGACCTGGTGAG
CAACGGTGGCGTGGCCATTGGCCTGCGGTTTGAGCGTGCT
CCCTTCATCACTCAGGAGCACACCTTGTGGCTGCCATGGG
GGCGTTTCTTCGTCATGGATACAATTGTGATGCGACACGA
GGTCAACGACATCCCCAGCTGTGACCTGAGCAGCTTCACC
CGTCCCATGCCCATCGTCCTGCCTGCTCCTTTGACAGCGT
TTGCAGGGACCTGCCCTGAGAGGGGCATCGTCGTTCCAGA
GATTCAGACCCTCCAAGAAGAAGTGCGGATCCCAGGTACA
GATATGCGCTTGGGCTACTTGAGCAGCCGGACTTCTGGCT
ATAAGTCTCTTCTGCGAATCACCCTCACCCACTCCACCAT
CCCGTTCAGCCTGATGAAGGTGCACCTTATGGTGGCCGTT
GAAGGAAGACTTTTCCGGAAGTGGTTTTCAGCTGCTCCCA
ACCTCTCTTACGACTTTGTTTGGGACAAAACCGACGTCTA
CAGCCAGAAAGTATATGGGCTGTCTGAGGCTTTCGTGTCG
GTGGGGTTTGAGTATGAATCCTGTCCAGATCTGATCCTCT
GGGAGAAGCGGACGGCTGTTCTGCAGGGATACGAGACCAC
TGCGTCAAATCTTGGTGGCTGGAGTGTGGACAAACACCAT
GCGCTGAACATTCAAAGTGGTATCCTTCACAAGGGCAACG
GTGAGAACATCTTCATTTCCCAGCAGCCTCCAGTCATAGG
AAGCATCATGGGTAATGGACGGAGGCGCAGTATCTCCTGT
CCGAGCTGCAACGGGCTGGCGGATGGAAACAAGCTGCTCG
CACCTGTAGCTTTAGCTTGCGGGTCGGATGGCAGTCTGTA
TGTGGGAGATTTCAACTACGTCCGTCGCATCTTCACAACG
GGAAATGTCACCAGCGTCCTAGAGCTCAGCAACAGCCCTG
CACACAAATATTACCTGGCCACCAGTCCTGTTTCAGGTTG
GCTGTACCTCTCGGACACCAGCAGCAGGAAGGTGTTCAAA
GTCAAGTCTCTGTATGCAGTGAAAGATGTGGCCAAAAACC
TGGAGCTGGTGGCGGGAACAGGAGATCAGTGTCTGCCATA
TGACGAGACTCGATGTGGGGACGGAGGCAAAGCTGTGGAG
GCCACACTCACCAACCCAAGAGGCATCACCGTGGATAAGT
ATGGTGTGATCTTCTTTGTGGACGGCACCATGATCCGCCG
CATCGATCAGAACGGCATCATATCCACCCTGCTGGGCTTC
AACGACCTGACTTCGGCTCGACCCCTCAGCTGTGACTCGG
TGATGGACATCTCGCAGGTGCGTCTGGAGTGGCCGACTGA
CCTCGCTGTGAGCCCCATGGACAACTCTCTTTATGTGCTG
GACAACAATGTAGTCTTACAGATCTCCGAAAACCATCAGG
TCAGGATTGTAGCAGGACGCCCCATGCACTGCCAGGTCCC
CGGTCTGGACCACTTCCTAGTCAGCAAAATCGCCATCCAT
GCCACCTTGGAATCAGCCAACGCTCTGGCCGTCTCCCACA
ATGGTCTTCTGTACATCGCAGAGTCGGACGAAAAGAAAAT
CAACCGCGTTCGTCAGGTTTCAACCAACGGTGAAATCTCT
CTGCTCGCTGGTGCCCCCAGTGGCTGCGACTGTAAAAATG
ATGCCAACTGTGACTGCTACTCTGGCGACGACGGCTACGC
GAAAGACGCCAAACTTAATGCTCCTTCATCGTTAGCGGTT
TCGCCTGACGGTGAGCTTTTTATTGCAGATTTAGGAAACA
TTCGTATTCGATATGTTCGTAGGAACAAAGCGTTCCTAAA
TCCACTCAATATGTATGAGATTTCATCACCAATTGACGAC
GAGCTTTACTTGTTCGATGTAAATGCGAGCCACGTCTTCA
CCCAAAGTTTGACCACCGGCGATTACCTCTACAACTTCAC
ATACTCTGGCGAGGGTGACTTGAGTAGCATCACTGATAAG
AATAAGAACCGTGTGAGCATCCGCAGAGACTCCACAGGCC
TGCCACTCTGGTTAATGGGGCCCGATGGACAGACCTTCTG
GTTCACCATGGGGACAAATAATGCGCTGAAGAGCGTGGCA
GCACAAGGACAGGAAATCGCCGTCATGACGTACCATGGCA
GCTCGGGCCTGCTGGCCACCAAGAGCAATGAGGACGGCTG
GAGCACCTTCTATGAGTATGACAACTACGGCCGGCTGACA
AACGTGACCTACCCTACAGGCCGGGTGAGCAGTTATCGCA
CAGACTCAGACAGCACTGTACGCGTGCAAACCGAAGGCTC
CAACAAAGAGGACATCACCGTCACCACCAACCTGTCAGCA
TCCGGAACATTCTACACGCTCATGCAGGATCAAGTCAAAA
ACAGTTACTACATCGGACTGGATGGCTCTTTGCGTCTGGT
ACTGGCAAACGGTATGGAAGTGTCTCTCCACACGGAGCCT
CACCTGCTGTCAGGAACAGTGAACCCAACCATAAGCAAGA
GAAACGTCACGCTGCCCATCGACAATGGACTCAACCTGGT
GGAGTGGAGACAGCGCAAAGAGCAAGCGCGAGGGCAGGTC
ACAGTATACGGACGCAGACTCCGGGTTCATAATAGAAATT
TGTTATCTATGGATTTCGATCGGGTAACCAGGACTGAGAA
AGTGTATGATGACCACAGGAAGTTCACCTTAAGGATCCAC
TATGATCATGCTGGAAGACCTACATTGTGGGCTCCAAGTA
GCCGGCTAAATGGTGTCAATGTTACCTACTCACCAGGTGG
CCACATTGCTGGCATCCAGAGAGGCACAATGTCAGTCCGA
ATGGAATATGACCAAAATGGGAGAATCACCTCAAAGATAT
TTGCAGATGGAAAATCATGGAGCTACACCTACCTTGAAAA
GTCCATGGTGCTGCTGCTCTACAGCCAGCGACAATACATC
TTCGAGTTTGACAAGAACGACCGCCTTTCTTCAGTAACCA
TGCCCAATGTGGCCAGACAGACCTTGGAGACCACCCGTTC
CATCGGCTATTACAGAAACACATACCGGCCACCTGAGGGC
AATGCCACAGTTTTGCAAGATTACAGTGAAGATGGACTGC
TTCTGCAAACCATCCACCAAGGAACAGGACGTAGAGTCAT
CTATAAGTATGGGAAACTCTCCCGTCTGCTAGAAATCCTT
TATGATACGACACGGATTGCCTTTTCTTATGATGAATCTG
CAGGCATGCTCAAAACTGTGGGGCTTCAAAGTGAAGGTTT
TGCTTGTACCATACGTTACAGACAGATCGGACCACTTATC
GACAGACAGATCTTTCGTTTTAGTGAGGAGGGCATGGTGA
ATGCCCGCTTCGACTACAACTATGACAACAGCTTCCGGGT
CACCAGCATGCAAGCAGTGATTAATGAAACCCCCTTGCCC
ATTGACCTCTATCGCTATGATGACGTCTCAGGCAAGACGG
AGCAGTTTGGCAAATTTGGAGTTATATATTATGATATTAA
CCAGATTATAACCACAGCTGTAATGACACACACCAAACAC
TTTGATGCATACGGAAGAGTTAAAGAAGTGCAGTATGAGA
TTTTCCGTTCGCTCATGTACTGGATGATGGTACAGTATGA
CAACATGGGGCGAGTGGTGGCCAAGGAGCTTAAAGTCGGA
CCCTATGCAAATACCACCCGCTATGCCTATGAATATGATG
CAGATGGTCAGCTCCAGGTAGTGTCCATCAATGATAAACC
TCTATGGCGCTACAGTTATGACCTTAATGGCAATTTGCAT
CTCCTTAGCCCTGGTAATAGCGCCAGACTTACACCACTAC
GCTACGACATTCGGGACCGCATTACTCGTCTAGGTGATGT
GCAGTACCGTTTAGATGAGGATGGATTCCTCAGGCAAAGA
GGCAATGATTTCTTTGAGTATAACTCTGCTGGGTTGCTTG
TTAAAACCTACAACAAAGTTAACGGATGGACTATCAAGTA
CCGCTATGATGGCTTGGGCAGAAGAGTGTCCAGTCGAAGT
ACCCAAGGCCACCATCTGCAATTCTTCTATGCAGACTTGT
CCAGTCCCACCAGAGTCACACACATGTACAATCACTCAAG
CTTAGAAATCACCTCACTCTACTATGACCTTCAAGGCCAC
CTTTTTGCCATGGAGTTGAGCAGTGGGGATGAGTTCTATG
TGGCATGCGACAACATTGGTACTCCACTGGCTGTATTTAG
TGGCGCTGGTCTCATGATCAAACAGATTCTCCACACAGCT
TTTGGGGAAGTATATTTAGACTCCAACCCAAGCTTCCAGC
TAGTAATAGGCTACCAGGGCGGCCTTTATGAGCCCCTTAC
AAAGCTTGTCCATATGGGCCGCAGAGATTATGATGTTCTT
GCAGGCCGGTGGACCACTCCTGACCATGATATCTGGAAGC
GGCTCAACAGCGACAACATTGTGCCCTTCAACCTCTACAT
GTTTAAGAACAACAACCCCTTGAGCAACAGCCAAGAAACC
AAGTGCTACATGACAGATGTTAACAGCTGGCTGGTGACGT
TCGGTTTCCAGCTATACAACGTCATCCCTGGCTACCGCAA
GCCTGTCACAGATGCCATGGAGCCTTCGTACGAGCTCATT
CACACCCAGATAAAGACTCAGGAGTGGGATAGCACCAAGT
CTGTTCTAGGGGTGCAGTGTGAAGTCCAGAGGCAGCTGAA
GTCTTTTGTCCGGTTGGAGCGGTTTGGTCAGATCTACAGT
GCAAGTGATTCTGGATGTCCTCCAACCCCTCTCCACACAC
TTTTTGCAACAGGGACTTCTCTCTTCGGGAAAGGTGTGAA
AGTCGCCATCCGTGAAGGTCGCGTTGAAGCGGACATCATC
AGCCTGGCTAATGAAGATGGCCGAAGGATCGCCGCAGTCC
TAGACAAGGCAAGCTACCTGCAGGACTTGCATTTCACCAT
TGCAGGCTTGGACACGCACTACTTTGTCAAATCAGGTCTG
GTAGAGGGTGATCTATCTCTGCTGGGTATGACAGTCGGCC
AGCGTACGCTGGAGACAGGAGTCAACGTAACAGTCTCGCA
GGTCAACATGGTCCTCGGAGGACGTTCGCGCCGCATAACT
GACATCCAGATGCAATACGGTACTTTAAGCCTTAATGTAC
GCTACGGCAGCAGTGTGGATGAAGAAAAGGTCAGAGTTCT
GGAGCTTGCACGACAGAGGGCGGTTGCAACCGCATGGGCC
CACGAGCGCCACAGACTACGGCAAGGAGAAGAGGGCTCTC
GGGCTTGGACGGACGGGGAAAGGCAGCAGCTCCTAAGCTC
TGGACGTGTACAGGGCTACGAAGGCTTCTACATAGTATCA
GTCGACCAGTTCCCAGAGTTGGCTGACAACATAAATAACG
TCCATTTCTTGCGACAGACTGAGATGGGACGCAGGTGACA
TGAACGCGAAGGAAACCCTCGCTCGGACTCGACGTCCCAG
ACTTCTTGCCAAAGACAAGTTGCGTTTGTGACCATATTAC
GTTACTTTATTTTTATGTTAACTGTGCCAGACTTTTTTTA
ATACATGACATACACGATTGCAAACAGTTTAACTGTTTCA
ACAGCAGAGTGCCCTTCTCTCTTTTGGTAATTCTTAAACC
CTCTTTGCCCTTCAAGTGCGGCTGCTAGAAGGTGGCATAT
GGCGGAGTCGGCGGTTTATGCCTTGGTGTTTGTGGGTTTG
CTCAAAGGAATATAGGAAGAAGGCTGGTAATGCATTATGC
TCACTGGCTCAGCCTGCTGCCAGACGAGCAGATTGTTATT
CACGAGCTTCACTCTACTCTGCCTTTTCCTGCGCCTCAGC
CAAGGAGAGACCTCTTTTAATCGCTTCTTTTTATACTTGA
AAGCCCACCGGCTGTGTCATACTTAAACAAGAACATTGGT
GTTTGCAGTGCATCGCTACCAGTTCAGATTCCTAACTGAA
CCCATCTCATGTTCAAAACTTGTTGTGGTGTCTTGTAATA
TTTTGGGACTGAGTGGTTTGCTGGTAACATCCTTTTATTA
TGATTTCCAGTTTTGACCAAATGGCTTAAAACACATAGGG
AAAGGGAACTTAACTGACAAGAGTTTAGGAGACAAGTAGG
AAATAGGTAGCCCCGTGGTCTTTAAAGATATGTGTGTAAA
TGATTCAGCACTGTTTGAATGAAAACAAAACCTAGTGAGC
TGCCTACCTAGATGCCATTTTAAAAGTTTGTTCTAATAGC
CTAGTTAGATTTAAGGCAGCATTGCAAGCTGTGTTCACAC
CATGTCAGAATTTCAACACATCCCCTTGACATCTGTCCTG
ATGAATTATTAGGAAGTAGTGCACACCCCAGATGTAATGA
CCACTTCACTTTGCTTCATAGCTTCATCACCGCCTCGTGT
GTGTTGTTGTCTATTAATTTAATAGGCTGTCATCAATTAT
CCCTTATGTAATTATGGAAAAACTGCCATGCTTAAACATA
GAACACAACTGAATCTGGCTTAGGTGGTACAGTGGTCACG
TAAATTTCTAATTTACGAATAGTAATAAATAGTTTTACAA
TAACATAAGGTTTTTTTTTATTTAATGATGACAAATTATG
ACATGGTGTGAACACACCTACATAAATGTAGGTAAAAAAA
AAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations