Transcript

tenm4-201

ID
ZDB-TSCRIPT-141209-2941
Name
tenm4-201
Previous Names
  • tenm4-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000057056 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000057056|OTTDARG00000001945|ZDB-GENE-990714-20 tenm4|OTTDARP00000044757 odz4-002 LG_none AL807754.8,CU929551.9,CU928223.11,CU856523.11 Danio rerio protein_coding KNOWN, 534 bp
CTCTCCACTGCGAGCTCACGGACTCAGCAGCTCCACGGCA
CACGGACGATATTCGCCCTCCAGCTCTGCGCAGTAAAAAC
ACACGGCTCGTCTTATTCATGCGCACTGCTCTCTCTTTCT
CTCTATGCGGAGCACTGGACATTTTACACCCTTTTCATTT
TTCAAACGGGAGATCATGATGATGATGATGGTGATAAGAC
ACCGATATTAACAGCATAACACCTTGCGGGGAGAGTGAAA
AAAAAGAAACGCTGGATAGACGCCTTCTCCTGCTTCTTCA
GCAATGTTGGGGGAAAAGAAAAGCTTTTTCTTCACTCCAG
TGGGTTTGGACATTGTGTATTCTAAAAGTGGGATCAGGAA
CAACAGCTGCCACATTTACATTCAAATGACTTTCAAGAGA
TCCTGCTTCGTAGTCTGGGCACCTATTCCCATGCAATTTC
TCCAGGTACACTCCCTCCAATCTGGGATGCTGACTGCCAA
GCTATTTTGCAACAACAATGGAGGGAAAAAAATATTATAC
TGCAATTCCATATT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations