ZFIN ID: ZDB-TSCRIPT-090929-6885
Transcript Name: kpna3-201
Previous Names: kpna3-001, ottdart00000023950

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000023950 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000023950|OTTDARG00000019485|ZDB-GENE-030616-541 kpna3|OTTDARP00000019837 kpna3-001 LG_ BX294379.5 Danio rerio protein_coding KNOWN, 3998 bp
CTCCGCACGTCGGTCGGGACTACAGGCGCACACACATACA
CACAGAGCCATGGCCGAAAACGCCGGCTTGGAAAACCATC
GCATTAAGAGCTTCAAAAACAAGGGGCGAGATGTGGAGAC
GATGCGAAGACATCGTAATGAAGTGACAGTAGAACTGAGA
AAGAACAAAAGAGACGAGCATCTCCTGAAGAAAAGAAATG
TTCCACAAGAAGAGAGTCTGGAGGACTCTGACGTGGACTC
TGACTTTAAAGGGCAAAATGTAACGCTAGATGCCATCTTA
CAGAACGCCACCAGTGACAATGCAGTGGTGCAGCTCAGTG
CAGTGCAAGCAGCCAGAAAATTGCTCTCAAGTGACAGAAA
TCCCCCTATAGACGACTTGATAAAATGTGGAATCCTTCCA
ATCCTAGTCAAATGCCTGGAGAGGGATGACAATCCTTCAT
TGCAGTTTGAAGCTGCCTGGGCTTTGACTAACATTGCATC
AGGGACGTCTGCACAGACACAGGCAGTGGTCAAATCCAAT
GCTGTCCCATTGTTTTTGAGACTTCTGCACTCTCCTCATC
AGAATGTGTGTGAGCAGGCCGTGTGGGCGCTGGGAAACAT
CATTGGTGATGGACCTCAGTGTAGAGATTACGTCATCTCG
CTCGGTGTGGTCAAACCTCTCTTGTCGTTTATTAATCCTT
CCATCCCCATAACCTTCTTGAGAAACGTCACCTGGGTCAT
TGTCAACCTGTGCCGAAACAAAGACCCTCCACCACCCATG
GAAACAGTACAAGAGATTCTTCCTGCCCTCTGTGTACTCA
TATATCATACAGATATAAATATTCTGGTAGACACAGTGTG
GGCTCTGTCGTATCTGACAGATGGAGGTAACGAGCAGATT
CAGATGGTAATAGACTCAGGTGTTGTCCCGTACCTTGTCC
CACTGCTCAGCCACCAAGAGGTCAAAGTTCAGACTGCAGC
GCTGAGAGCGGTGGGGAACATTGTAACCGGGACAGACGAG
CAGACTCAGGTGGTGCTCAACTGTGATGTTCTTACTCACT
TTTCCACCCTGCTCACACACCCCAAAGAGAAAATCAACAA
GGAGGCGGTGTGGTTCCTGTCTAATATAACAGCAGGAAAC
CAGCAGCAGGTGCAGGCTGTAATAGATGCTGGTCTCATAC
CCATGATCATTCACCAGCTTGCCAAGGGTGATTTTGGGAC
ACAGAAGGAGGCTGCATGGGCCATCAGCAACTTGACAATA
AGTGGAAGAAAGGATCAGGTGGAGTACTTGGTGCAACAAA
ACGTGATCCCACCCTTCTGCAACCTGCTCTCGGTGAAAGA
TTCTCAGGTGGTCCAGGTGGTCCTCGACGGACTGAAAAAC
ATCCTTATCATGGCCGGGGAGGAAGCCAGCACAATTGCTG
AGATCATTGAAGAGTGTGGAGGATTGGAAAAAATCGAGAA
CCTCCAGCAGCATGAAAACGAGGACATCTATAAACTTGCA
TTTGAAATCATTGATCAGTACTTTTCAGGAGATGATATTG
ATGAAGACCCAAGTCTGATTCCCGAGGCCACCCAAGGAGG
CACATTCAACTTCGATTCCTCCAACCTACAAGCCAAGGAG
TTTAAGTTCTAGACAACATCTGGAGCGTCGAACTTAGGAT
TGGTGGGTTTCCCAGCTGCTCCTCAACACCCTGCCACCTA
CTGACCCATCACCTACCAACCACTCACTAACCAGACAAAA
CCAACCAGTCACCGTGCTCAGAAACAATACTCTCACTCAC
TCACACAGAAAAGAAATCGCACTGAAGGATCCGAGTACCC
GCCTCGACGCCACTCAAAACACGGATGGATCTAAAAAATA
AAACTCAAAAGAACAAGACTCATTACACTGCAGTTGCCAA
AAAACAAAAGAAAAAACTAACAAAAAAAGATATATATTTT
GCTCTTTCTTTCACACACAAACACACACACACACACACAT
AGGTGAGCATGAACAATGATAGGAACTTCTGTTGTTGTAC
CAGCCATCATATCAGCCAAGGAAGATGAAGAAAGAGAAAT
TCCTGAAATTAAAAAGGCTTTCGGTTTCCAAGAAAGCCCT
TCTCTGGAATGGTGGTGATTTTCGAGTCTCAGACAGACAC
CCAACTCGATACGTCCAGCCTCTACTGTGTTAAGCCATTT
GGACCTTCTCCCTCATTCATCTGTGAACTAGCCTCCGATG
GCTTATTCAAAGGAATATTGTTCAAGTGGGGGAAGGGAGC
GTCTCTAAAATATGTGGTGTGCAAACAGAAACACTTTAAT
TATCACCACCAGTTCTTGCTTTCTTTTCTTCATCCTGAAA
TTATGGACAATACACTGAAGATACAGAAACTTGAATGGAG
TAAATCTCCTCAGTCGAGCACCCTTGTTTTCAAAAGTTCT
GCAGCGATAAGTGTCGTGGACATTCATTGTGCCGATCTTT
TTTGGTTTGCAATGGCATAGGAGGATACGATCAATTTGGC
CAGGACTTTTAAAGGGCCGCCCCAACCTTTGGAAGTTCTT
CAAGATAACCTCAAGAGGTCTTTCTGCTTAACACGGGTGC
TCTGGCAGCGCTCTTTGTTTCCTGGATTCATCTTCTCTTC
TTCCTGTCTGTAATCATAGTAATAAGTTCATCGGGAGAAC
CCCAATCGTAACCGGTTGGAGGATGTTTTCACTAAATCAG
TACATTTCAGCACTCGATAGTCAAGAAACTCTGCAACAGT
GATTGGATTGTGAATTCTTTTTTTGTTTTGATCAGTGGAG
CTTCCGCTTTTGCAGTTTTTCCAGTCTTACGCATACACTT
TTTTGGGTTTTTTCCCGTTTTATTGCTTAATGTAAGTGGA
GAGCGATGTTCGCTTAATTTTGACTATACAAGCAATGGGA
AAAGGTGATCCATGACGTTTTTGTTTAGTTGGTTTTTAAA
TCCTATTTCACTTGCTGCAAAACCTAATCTTACCAACTAA
AATAAAAGTATATTTCTTGTTTAGGTATATAATGAGAAGC
TACCACACTTAGGTCCACTAGACGTTGGGACGCTACAAAA
CAATAACAACGTTATGATTATCGATTTACAGCCAATAGGG
GTAATTATTATTTTCTTTCGTTTGCAATGGCAAATGATTG
CCATTATTTGGAAAATGGGCTTTCTTACTGTTGTGACTGG
ACGTTTTATTTGTTGTTCTTTTTTCCCCCTGTGCATTAAC
TTGTAAAGGGATGTATGAGAAAAAGAAATTTACATTTGGA
CTGAGGTAATTGTATTTGAGCGGCAAATACAGCAAGGAAG
CTAAAGGCAGCCCTGATGATTTTGTTTTTTTGAATTCGCC
ATTTATTGTTGAACAAAATAAAGCAGGTTTGAAATTCATG
AACTTATCTAGACATCTAGAAAACGAGCCACTTTAAAGAC
GTTTCGTCTTGTATCGGAAATGGATACAAGCTTATTGCTT
GTTGCAAGATTTTTACTTGCTGAAGAAAAAAAAAATTAAT
CTAAAAACGGCGACAGATCGCATTTTGGCCTCTGATTGTT
TGTATGTTTTTATAAATTTTAGAACTGAATTTCTCTTTAA
GGTGGCTCATCAGTATTTTTTTCAACTCTTGTGCATATTA
AAGATAAAGAATGAGTTGAAATTCATTGTGCCTTTGTTTT
TCATTTCGAAGCAACTAAAAAAAGAGGTTCATAATGCCTG
CCACGTTGCATTGGAGCTGCTTATAATATGGGGTCTTCTG
GGTGTCATATCTGGACTTTACAATGAGACGTTCTCTGGAG
TAGAGTTATAATTCTATTTCAATTCTCCTCTAGTTTGCTG
GCTGACTTGTAATTGATCCTCTAACTTTCATTCTGCTCCC
TTCTCATTCTTGTTCACTATTCTCAGCTTGTCCCTGCCCC
GCCCTCCCACCTCCTCCCATCCACCTTTCTATGGCAACAC
ATCTTTCACTCATCACTCCCTCAGGACGTGCTTTATGTAT
CAATGAACCTAACCAAAATAAACGTGCTGTTAGCCATC

kpna3 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA kpna3-201 3998
ottdart00000001842 (1) 1816
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
kpna3-201 Contained in:
[BAC] DKEY-7A20 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000023950 (1),  Ensembl_Trans:ENSDART00000074519 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:AY391433 (1) 2236 nt
GenBank:BC055253 (1) 1878 nt
GenBank:CT652782 (1) 885 nt
GenBank:CO931328 (1) 884 nt
GenBank:CA473308 (1) 877 nt
GenBank:CT728711 (1) 877 nt
GenBank:CT650389 (1) 868 nt
GenBank:CT694061 (1) 851 nt
GenBank:CT706484 (1) 846 nt
GenBank:DN835969 (1) 842 nt
GenBank:CT701441 (1) 797 nt
GenBank:DT070807 (1) 797 nt
GenBank:DV596452 (1) 741 nt
GenBank:AL722386 (1) 730 nt
GenBank:CK710482 (1) 714 nt
GenBank:CT714977 (1) 679 nt
GenBank:AL722332 (1) 642 nt
GenBank:CB359490 (1) 542 nt
GenBank:CR930513 (1) 517 nt
GenBank:CD591888 (1) 500 nt
CITATIONS (2)