ZFIN ID: ZDB-TSCRIPT-090929-22639
Transcript Name: ottdart00000001842
Previous Names: busm1-79f24.2-001, si:busm1-79f24.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: AB
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000001842 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000001842|OTTDARG00000001724|ZDB-GENE-030616-541 kpna3|OTTDARP00000001627 BUSM1-79F24.2-001 LG_ AL606727.3 Danio rerio protein_coding NOVEL, 1816 bp
CAGGCGCACACACATACACACAGAGCCATGGCCGAAAACG
CCGGCTTGGAAAACCATCGCATTAAGAGCTTCAAAAACAA
GGGGCGAGATGTGGAGACGATGCGAAGACATCGTAATGAA
GTGACAGTAGAACTGAGAAAGAACAAAAGAGACGAGCATC
TCCTGAAGAAAAGAAATGTTCCACAAGAAGAGAGTCTGGA
GGACTCTGACGTGGACTCTGACTTTAAAGGGCAAAATGTA
ACGCTAGATGCCATCTTACAGAACGCCACCAGTGACAATG
CAGTGGTGCAGCTCAGTGCAGTGCAAGCAGCCAGAAAATT
GCTCTCAAGTGACAGAAATCCCCCTATAGACGACTTGATA
AAATGTGGAATCCTTCCAATCCTAGTCAAATGCCTGGAGA
GGGATGACAATCCTTCATTGCAGTTTGAAGCTGCCTGGGC
TTTGACTAACATTGCATCAGGGACGTCTGCACAGACACAG
GCAGTGGTCAAATCCAATGCTGTCCCATTGTTTTTGAGAC
TTCTGCACTCTCCTCATCAGAATGTGTGTGAGCAGGCCGT
GTGGGCGCTGGGAAACATCATTGGTGATGGACCTCAGTGT
AGAGATTACGTCATCTCGCTCGGTGTGGTCAAACCTCTCT
TGTCGTTTATTAATCCTTCCATCCCCATAACCTTCTTGAG
AAACGTCACCTGGGTCATTGTCAACCTGTGCCGAAACAAA
GACCCTCCACCACCCATGGAAACAGTACAAGAGATTCTTC
CTGCCCTCTGTGTACTCATATATCATACAGATATAAATAT
TCTGGTAGACACAGTGTGGGCTCTGTCGTATCTGACAGAT
GGAGGTAACGAGCAGATTCAGATGGTAATAGACTCAGGTG
TTGTCCCGTACCTTGTCCCACTGCTCAGCCACCAAGAGGT
CAAAGTTCAGACTGCAGCGCTGAGAGCGGTGGGGAACATT
GTAACCGGGACAGACGAGCAGACTCAGGTGGTGCTCAACT
GTGATGTTCTTACTCACTTTTCCACCCTGCTCACACACCC
CAAAGAGAAAATCAACAAGGAGGCGGTGTGGTTCCTGTCT
AATATAACAGCAGGAAACCAGCAGCAGGTGCAGGCTGTAA
TAGATGCTGGTCTCATACCCATGATCATTCACCAGCTTGC
CAAGGGTGATTTTGGGACACAGAAGGAGGCTGCATGGGCC
ATCAGCAACTTGACAATAAGTGGAAGAAAGGATCAGGTGG
AGTACTTGGTGCAACAAAACGTGATCCCACCCTTCTGCAA
CCTGCTCTCGGTGAAAGATTCTCAGGTGGTCCAGGTGGTC
CTCGACGGACTGAAAAACATCCTTATCATGGCCGGGGAGG
AAGCCAGCACAATTGCTGAGATCATTGAAGAGTGTGGAGG
ATTGGAAAAAATCGAGAACCTCCAGCAGCATGAAAACGAG
GACATCTATAAACTTGCATTTGAAATCATTGATCAGTACT
TTTCAGGAGATGATATTGATGAAGACCCAAGTCTGATTCC
CGAGGCCACCCAAGGAGGCACATTCAACTTCGATTCCTCC
AACCTACAAGCCAAGGAGTTTAAGTTCTAGACAACATCTG
GAGCGTCGAACTTAGGATTGGTGGGTTTCCCAGCTGCTCC
TCAACACCCTGCCACCTACTGACCCATCACCTACCAACCA
CTCACTAACCAGACAAAACCAACCAGTCACCGTGCTCAGA
AACAATACTCTCACTCACTCACACAGAAAAGAAATCGCAC
TGAAGGATCCGAGTACCCGCCTCGACGCCACTCAAAACAC
GGATGGATCTAAAAAA

kpna3 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA kpna3-201 (1) 3998
ottdart00000001842 1816
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ottdart00000001842 Contained in:
OTHER ottdart00000001842 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000001842 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCESNo data available
    CITATIONS (1)