Transcript

higd1a-002

ID
ZDB-TSCRIPT-090929-6705
Name
higd1a-002
Previous Names
  • hig1-002
  • ottdart00000023731
  • zfinnucl0000002783
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000023731 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000023731|OTTDARG00000019345|ZDB-GENE-030826-15 higd1a|no_translation hig1-002 LG_ CU929426.5 Danio rerio protein_coding KNOWN, 744 bp
CACGCAGCAGTTGAACCGGCGAAAAGAGAGCAGCTTTTCT
TCTCTACAGTGGGAAATACTTATATAGCCAAGATGAGCGA
CATTGGATACGAAGACAATGAGTCCAAGTTGATGAGAAAA
ATCAAGCAGAATCCATTCGTCCCTGCAGGTAAACTGTTGT
GAATTATTAATATTAGATATGAAATTGGTCATGTTTTTAT
TTTCGGTTCATGGGGTTTCTATTTGTTAAGTTTTTTTATT
AAAAGTTTTCAGTATTTCAATGTTTGAGAAGATAAATTGT
CAACGTGTGTAACGGATGTATTAATATTCAGATAAAACAA
CAATCTCATTCTGTGCTTTTGAATGTCTCTCAAATAATAA
ATGATCATCCTAAATTTGATCATATTCTAAGCGATTTTTA
GGCAAGCCTAGTGGTTTAAAGGTTAATGGCAACGTATAGA
GAGTAAAACTGGCAGTGAATTAGTGTTTGTGGCTGTACTG
TGATCCATACATTTTCTTTTATCATGAAATCAAATGATTC
TTGTTCTAGATATGAACTACTGTTACTCAGAATTACATTT
TAGTGGGAGTCTTACTGTAAATCATGTTTAAAGATGAATG
TTAGTCATTTTTTGGCTCAGGAATGAATAAGAGGCTGAAT
TTTACTGTACGGAGAAGTTTTATTGCACGTTTTTTGATAG
TTGAAGGCAAAATAATTAACCGTCTTGTGAAATTAAAAGT
TTGAAATCCAAAATTAAATATATA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations