Transcript

higd1a-201

ID
ZDB-TSCRIPT-090929-6704
Name
higd1a-201
Previous Names
  • hig1-001
  • higd1a-001
  • ottdart00000023730
  • zfinnucl0000002987
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000023730 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000023730|OTTDARG00000019345|ZDB-GENE-030826-15 higd1a|OTTDARP00000019681 hig1-001 LG_ CU929426.5 Danio rerio protein_coding KNOWN, 1263 bp
GTTACATCACAGTGTTCCCGGCACGCCGACAGTCACACGC
AGCAGTTGAACCGGCGAAAAGAGAGCAGCTTTTCTTCTCT
ACAGTGGGAAATACTTATATAGCCAAGATGAGCGACATTG
GATACGAAGACAATGAGTCCAAGTTGATGAGAAAAATCAA
GCAGAATCCATTCGTCCCTGCAGGGATGGCTGGGTTCTTT
GCCATTGTGGCGTACAGACTGTTCAAGCTGAAGAGCCGAG
GAGACACAAAGATGTCAGTGCACCTGATTCACATGCGTGT
GGCTGCACAAGGCTTCGTGGTCGGAGCCATGACTTTAGGA
GTCATCTATTCGATGTACAACGAGTATATTCTGAAACCCG
CCGAAGCACAGAAGGCGCTGGAGCAGAAAGCGTTGGAAAA
GAAGTGAAGAGTTTTGTTGGTTTCCTGAGATATCCTTCGT
ACCACCTCATATTAAGGTGTCCCTTAAAGTGTATTTATAG
CGAACTTTTTGTTTACTTCTTATTTCTTTACACCGTTTCC
TATTTAAACCTAATAAGCCTCGGATCAGGAGGTTTGTGTG
TTCATGGCACGTTTGAGGAATGACAAAATAGTTCCTATTT
TGAATCTGCCAACTATTATTTATTTCTCATATCAGTAACG
CGCTGATAATCACAGTATAAAATGTATTTTATTTTATTTT
TGGAGTTTTTTCAAAAGTTTTGCTGCTTTTATTTTCATTT
TGTGCCCTAGTTTTATGAATAAGGTGTGGCATGAAAACCT
TTGTACCTTCTAATTTAGGATTTTTTTCTTGTATTATTTA
TATAGACTAGCAGAGCCAATAATGCGCGCAATTATTGTGT
ATTGCCATACACCCAAAGCGCTTTACAATTGTGTGAGGGC
GTCTCTAACATAAGTCTAGTCATGATTCATAAACACACTG
AACCTAATATGGGGAATTTACCCGTGTTAAATTACTATGG
TACAAGGAGCCCCTAACAGGATATACAGGAGTTCAGTCAA
CGCACAGTTTTGTTTATTCAGTTTGAGGAGTGTGTGTGTG
TGAGAGATAGAGAGAAAGTGTGTGTGTGTTTGTGAAAGTA
TTAGCATGATATTTCCTAGATTGAATGGTTGTGTATCTGT
GTGGAGCGATTATTTCACCTCTTTGTTTTATATTTCGACA
TAATTTCACAAAGTCCTAGTTTTAGAGTGAGCTATATTTT
GAGGATCTCAGCTTCAACTTTGTTTATCTTTGCCAATAAA
ATAAAAAAATGTGTAATTTTAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations