header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-6541
Transcript Name: grk3-201
Previous Names: adrbk2-001, ch211-142e17.2-001, ottdart00000023467, si:ch211-142e17.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000023467 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000023467|OTTDARG00000019173|ZDB-GENE-030616-382 adrbk2|OTTDARP00000019497 CH211-142E17.2-001 LG_ CR385083.14 Danio rerio protein_coding NOVEL, 834 bp
CCTGCGAATATCCTCTTAGATGAGCACGGACACGTCCGCA
TCTCTGACCTGGGTCTGGCCTGTGATTTCTCCAAGAAGAA
GCCTCACGCCAGCGTAGGGACTCATGGCTACATGGCACCT
GAGGTTCTGCAGAAGGGAACGGCGTACGACAGCAGCGCCG
ACTGGTTCTCTCTGGGCTGCATGCTGTTCAAACTCCTGCG
AGGGCACAGTCCATTCAGGCAGCACAAGACCAAAGACAAA
CACGAGATCGACCGCATGACGCTTACCATGAATGTGGAGT
TGCCTGATTCCTTCACTCCCGAGCTCAAGTCTCTCCTGGA
AGGACTCCTACAGCGAGATGTGGCCAAACGATTGGGCTGC
CTGGGACGAGGGGCGTCAGAGGTGAAGGAGCACGTGTTCT
TCAAGGGAATCGATTGGCAGCAGGTTTATCTCCAGAAGTA
TCCTCCACCACTCATCCCCCCCAGAGGAGAGGTCAACGCT
GCGGACGCCTTCGACATCGGCTCCTTCGACGAAGAGGACA
CCAAGGGAATCAAGCTTCTGGACAGCGATCAGGAGCTGTA
TAAGAACTTTCCGCTGGTGATCTCCGAGCGCTGGCAGCAG
GAGGTGGCCGAGACCGTGTATGAAGCTGTGAACAGCGACA
CGGATAAAAACGAGGCTCGCAAGAGGGCCAAAAACAAGCA
GCAAGGCCACGAAGAAGATTACGCGCTGGGGAAGGACTGC
ATCATGCACGGCTACATGCTAAAGCTAGGAAACCCCTTCC
TGACGCAGTGGCAGCGGCGCTATTTCTATCTGTTCCCCAA
CCGTGTGGAGTGGAGAGGTGAAGGAGAGTCTCGG

grk3 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA adrbk2-001 (1) 1776
grk3-201 834
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
grk3-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000023467 (1),  Ensembl_Trans:ENSDART00000162176 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)