header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-23208
Transcript Name: adrbk2-001
Previous Names: busm1-221d18.1-001, ottdart00000001808, si:busm1-221d18.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: AB
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000001808 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000001808|OTTDARG00000001694|ZDB-GENE-030616-382 adrbk2|OTTDARP00000001595 BUSM1-221D18.1-001 LG_ AL591170.5 Danio rerio protein_coding NOVEL, 1776 bp
ATTAAAGAGTACGAGAAGTTGGACTCAGAAGAGGAGAGGC
TAACTCGCAGTCGACAGATTTATGACGTCTACATAATGAA
GGAGCTGCTTTCATGTTCACATCCCTTCTCCAAGAAAGCC
GTCGACCATGTCCAGACTCACCTAGCAAAGAAACAAGTTC
CTCCAAATCTCTTTCAGCCATATATTGTTGAAATCTGTGA
CAGTCTTCGAGGGAATATCTTTCAGAAGTTCATTGAAAGT
GACAAGTTTACACGTTTCTGCCAGTGGAAGAATGTAGAGC
TCAACATCCATTTGACGATGAATGACTTCAGCGTGCACCG
CATCATCGGCAGAGGAGGCTTTGGAGAGGTTTATGGATGC
AGAAAGGCAGACACGGGGAAGATGTATGCTATGAAGTGTC
TGGATAAAAAGCGTATCAAAATGAAGCAGGGAGAAACTCT
GGCGCTTAATGAGAGAATCATGCTGTCGCTGGTCAGCACC
GGGGACTGCCCGTTCATAGTGTGTATGACATATGCCTTCC
ACACCCCTGATAAACTGTGCTTCATCCTGGACCTGATGAA
CGGTGGAGACCTCCACTATCACCTGTCTCAGCACGGGGTC
TTCAGCGAGAAGGACATGCGCTTTTATGCAGCGGAGATCA
TTCTGGGCCTCGAACACATGCACAACCGCTTCGTCGTCTA
CAGAGACCTCAAGCCTGCGAATATCCTCTTAGATGAGCAC
GGACACGTCCGCATCTCTGACCTGGGTCTGGCCTGTGATT
TCTCCAAGAAGAAGCCTCACGCCAGCGTAGGGACTCATGG
CTACATGGCACCTGAGGTTCTGCAGAAGGGAACGGCGTAC
GACAGCAGCGCCGACTGGTTCTCTCTGGGCTGCATGCTGT
TCAAACTCCTGCGAGGGCACAGTCCATTCAGGCAGCACAA
GACCAAAGACAAACACGAGATCGACCGCATGACCCTTACC
ATGAATGTGGAGTTGCCTGATTCCTTCACTCCCGAGCTCA
AGTCTCTCCTGGAAGGACTCCTACAGCGAGATGTGGCCAA
ACGATTGGGCTGCCTGGGACGAGGGGCGTCAGAGGTGAAG
GAGCACGTGTTCTTCAAGGGAATCGATTGGCAGCAGGTTT
ATCTCCAGAAGGGAGAGGTCAACGCTGCGGACGCCTTCGA
CATCGGCTCCTTCGACGAAGAGGACACCAAGGGAATCAAG
CTTCTGGACAGCGATCAGGAGCTGTATAAGAACTTTCCGC
TGGTGATCTCCGAGCGCTGGCAGCAGGAGGTGGCCGAGAC
CGTGTATGAAGCTGTGAACAGCGACACGGATAAAAACGAG
GCTCGCAAGAGGGCCAAAAACAAGCAGCAAGGCCACGAAG
AAGATTACGCGCTGGGGAAGGACTGCATCATGCACGGCTA
CATGCTAAAGCTAGGAAACCCCTTCCTGACGCAGTGGCAG
CGGCGCTATTTCTATCTGTTCCCCAACCGTGTGGAGTGGA
GAGGTGAAGGAGAGTCTCGGCAAAACCTGCTGACCATGGA
GCATATCGTGACGGTGGAGGAGACGCAGATCAAGGACAAG
AAGTGCATCCTGCTGAGGGTTAAAGGAGGGAAGCAGTTCG
TCCTGCAGTGTGAGAGCGACCCAGAGTTCGTCCAGTGGAA
GAAGGAGCTGACCGAAGCGTTCACCGAGGCCCAGAAGCTG
CTGCGTCGAGCTCCTAAAGTCATCGGCAAGGGCAGAACTA
ACGTGGTGGAGCTCTCCAAACCTCCGCTCACACACCGCAA
CAGCAACGGCCTGTGA

grk3 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA adrbk2-001 1776
grk3-201 (1)    Ensembl 834
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
adrbk2-001 Contained in:

Genome Resources: Vega_Trans:OTTDART00000001808 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (1)