ZFIN ID: ZDB-TSCRIPT-090929-6357
Transcript Name: rpl12-003
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000023183 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000023183|OTTDARG00000018965|ZDB-GENE-030131-5297 rpl12|no_translation rpl12-003 LG_ CR925757.8 Danio rerio protein_coding NOVEL, 818 bp
TCGGCCTTTTCCTTTTTCACTTTTGTGGTGAAGGTGCAAC
AGTTTTCGGTCGTCCCGAATCCGGGTTCATCCGACACCCT
CACCAATTCCAATTGAAGTGAACTCAACTTCATCTGATAC
ACCATGCCTCCTAAATTCGACCCCAACGAGATTAAAGTTG
TGTTCATGAGATGCACTGGTGGAGAGGTCGGTGCCACTTC
CTCGCTGGCCCCCAAAATTGGACCTTTGGGTCTTTCCCCT
AAAAAGGTGGGTGATGACATCGCAAAGGCCACCGGTGACT
GGAAGGGCCTGAGAATCACTGTGAAGCTGACCATCCAGAA
CAGACAAGCAGCGATTGAGGTAGTGCCATCAGCCTCTGCC
CTCATTATCAAGGCTCTGAAGGAACCTCCCCGTGACAGGA
AGAAGGTCAAGAACAGTAAGTGGCTTTTTACCCCACCTCA
ATGCACTATTGTAGGAATGGCATCTTTTGTGTCTTGTGAC
CTTTTGTGGCTATGGACCGTGAGCCTCCCGCCACTGTGCT
TGTCTGTAAGAGTGACTGTGTACTGTCCAGAGGAGGCTCA
GAGTGACCCAGCTCTAGGAAGCAGAACTGCCCAGTTTCAT
GGGTAACTCTGTGCCGAAAGGTCTGGGACATGTTTACTTG
TGCAAATCAGAGCTTTATTGTATGGTAGAATATAGTGCAC
GCATACAAGGCACGATATTCATGGTAAAGGATATGAAAAA
TGGAAATATTTGCCAGTAAAAACATTAAGGATACAAGTTT
GTGGTCAGTAACTTATTTAATTAAATGTTGCTGCTAAAAT
ATTTACATCAATCCTGAA

rpl12 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA rpl12-002 (1) 766
rpl12-003 818
rpl12-004 (1) 569
mRNA rpl12-201 (1) 787
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rpl12-003 Contained in:
OTHER rpl12-003 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000023183 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:DN768465 (1) 826bp
    CITATIONS (1)