header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-6355
Transcript Name: rpl12-201
Previous Name: rpl12-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000023181 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000023181|OTTDARG00000018965|ZDB-GENE-030131-5297 rpl12|OTTDARP00000019298 rpl12-001 LG_ CR925757.8 Danio rerio protein_coding NOVEL, 787 bp
CTTGCGCTCTCTTCGGCCTTTTCCTTTTTCACTTTTGTGG
TGAAGGTGCAACAGTTTTCGGTCGTCCCGAATCCGGGTTC
ATCCGACACCCTCACCAATTCCAATTGAAGTGAACTCAAC
TTCATCTGATACACCATGCCTCCTAAATTCGACCCCAACG
AGATTAAAGTTGTGTTCATGAGATGCACTGGTGGAGAGGT
CGGTGCCACTTCCTCGCTGGCCCCCAAAATTGGACCTTTG
GGTCTTTCCCCTAAAAAGGTGGGTGATGACATCGCAAAGG
CCACCGGTGACTGGAAGGGCCTGAGAATCACTGTGAAGCT
GACCATCCAGAACAGACAAGCAGCGATTGAGGTAGTGCCA
TCAGCCTCTGCCCTCATTATCAAGGCTCTGAAGGAACCTC
CCCGTGACAGGAAGAAGGTCAAGAACATCAAGCACTCTGG
AAGTGTTGCTTTTGATGAGATCGTCAACATTGCCCGCGTC
ATGAGGCACAGATCAATTGCCAGGGAACTTTCAGGTACCA
TTAAGGAGATTCTTGGCACAGCTCAGTCTGTGGGCTGCAC
CATTGATGGTCGCCTTCCCCATGATGTCATTGATGACATC
AACAGCGGTGCAGTTGAGTGCCCAACTGAGTAAAATGGAG
GATTGAAGACCAAAATAAATTTTTCATAAGCATAAAGTTT
GACTTCTGTGGTTTGTGACCTTCTATAATCCTCAATGTAT
TGTAGAGAAGGGATCTGGGCCTTGAGGTGAGAGGATACTT
TAAAAGGAAAATGTTTAGTATTAAAGT

rpl12 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA rpl12-002 (1) 766
rpl12-003 (1) 818
rpl12-004 (1) 569
mRNA rpl12-201 787
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rpl12-201 Contained in:
OTHER rpl12-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000023181 (1)
  • Ensembl_Trans:ENSDART00000008807 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC090905 (1) 980bp
    GenBank:CN835920 (1) 902bp
    GenBank:CO923801 (1) 900bp
    GenBank:CN172595 (1) 871bp
    GenBank:DT868966 (1) 692bp
    GenBank:BC049061 (1) 672bp
    CITATIONS (2)