ZFIN ID: ZDB-TSCRIPT-090929-6337
Transcript Name: lman1-001
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000023145 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000023145|OTTDARG00000018936|ZDB-GENE-060201-4 lman1|OTTDARP00000019266 lman1-001 LG_none CU694483.6,BX248399.5 Danio rerio protein_coding KNOWN, 2104 bp
CTGCGCTACGTCAGCACTCAGACTCAAACATGGCGGTACC
CATTGCCAAGTGCCTGGCAGCTTATGCCCATTTATTAATA
ATTTCTGTAATATTTCCGCACCTTTTCGCTGACAGCGCTA
CCGGGGACCTGCCGCACCGCCGCTTTGAGTATAAATACAG
TTTCAAAGGGCCACATCTGACACAGAGTGATGGAAGAATC
CCATTCTGGATTCATACTGGCAATGCTATTCCCAGTTCAG
ATCAGGTCCGAATCACACCTTCTCTCCGGAGCCAGAAGGG
TTCAGTATGGACAAAGTCCCCTGTGAGTTTTGAACATTGG
GAAGCTGAAGTGGCATTTCGTGTTTCCGGACGAGGACGAA
TGGGAGCAGATGGATTGGCCATATGGTTCACGGCTGGTCA
AGGCCTGGAGGGTCCCGTGTACGGGGCCGCTGATCAGTGG
AACGGCGTGGGAATATTCTTTGACTCTTTTGATAATGATG
GAAAGAAAAACAACCCTGCTGTCCTGGTGGTGGGCAACAA
TGGGAAACTTGTTTTTGACCATCAAAATGATGGCACGACC
CAGGCACTAGGCACATGTCTTAGAGACTTCAGAAACAAAC
CTTACCCTATACGCACCAAAATCACTTATTACAAGCAGAC
GTTATCGGTTTTCATTAATAACGGCTTCACTCCTGACAAA
GATGATTATGAGTTCTGTACCAAAGTTGAGAACATGATCA
TTCCTGGAACTGGTTATTTTGGCATCTCTGCAGCCACTGG
AGGACTTGCAGATGACCATGACGTTCTGTCATTTTTGCTG
TTCAGGCTTACAGAACCTGGGCAGAATCTGCCTCCCCCAG
AAAAAGAGATTCCCAAAGAGGAGAAGGACAAGTACCAGGA
GGAATTTGAGAATTTCCAACAAGCTCTGGACAAAAGGAAA
GAGGAGTTTCAGAAAGAGCACCCTGATGTCCAGGGGCAGC
CCATTGAGGACCTGTATGAAAGCGTTAACGATCGGGAAAT
CCGTCAGGTGTTTGAGGGGCAGAATCGAATTCACCTGGAG
ATCAAGCAGTTGAACAGGCAGCTGGCAATGATTCTGGACG
AACAGCGGCGTTATGTGTCAGTCATCACAGACGAGATCAA
CAAACGCACCTCACAAGCACAGTCTGGACAGGCTCCTAGT
CATGAACTGGAGACAATTATTACCACACAACACGAGGTTT
TGAAGAATATTAATGAAGTAAGGAACTCTCTGTCAGGCTC
TCTGAAGCAGCTGGCAATGGGGCAGCATCAGGGAAACGCA
GGAGGATTGGGCTCATATGAAACTGTCCAGCACTTCAATG
ACATCAAGGAGCATCTGCACGTTGTCAAGAGGAACATCGA
GCACATTATTCAGAAAAATGCTAATCCTGCAGAGAAGCTG
AAGTGCCCTGAACTTCCTCCATTACCAACCTGTCTCTCGA
CCACACACTTCCTCATCTTTATTGTCATCCAGTCCCTCCT
CTTCTTCGGCTACATCATGTACAAGAGTCAGCAAGAAGCA
GCGGCGAAGAAGTTTTTTTGATGATTCGTAGTTCTTGGTA
AACGCAGCACAACATGTAAATTGTCCACTTTTGTTAATTT
CCCGTTTGTTTTCTGTTGGCAAACTGTAAATTTATTCTAC
TTGAAGTATTTAGTTAGTTTAGCAGTTTTTTGTTTTAATT
CTGGACTTTTTAATTTGATCAGAGTTGTACAGTATTTGAA
TGACTGCTCTTTTCCTGAGTGTGTGTGGTATTTTCAGCAG
AAGATTCCTGAATATGATGTAATATATTCTTTAGAGGTCG
GACATTATATTTGCTGTTCAATGCTGGTCCAGGAATCATT
TCAAGAACTTGATTTACTGTCGAGGCGACGTTCTCAACTG
TGGTGGTAAAACAAACTGCAAATCGATCAAGTGTTTTAGC
ACATTCTCTTTTGGCAATACCTTTACAATAAGACAGTTTT
CCCCTACAAAAGTGTTAAAGCTTTATTGTAATGGCAAAAG
CAAGAACCCAGAGGCTTGAATGTGTTTTGAATCTCTCTAA
AAAAAAAAAATACAAAGATGTTTTTCTGCGCAAACAATTT
ACATAAAACACCAATCAAATGATA

lman1 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA lman1-001 2104
lman1-002 (1) 300
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
lman1-001 Contained in:
OTHER lman1-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000023145 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC091860 (1) 2075bp
    GenBank:EV761413 (1) 922bp
    GenBank:EE301922 (1) 915bp
    GenBank:EG576586 (1) 901bp
    GenBank:CK702720 (1) 823bp
    GenBank:AW175541 (1) 707bp
    GenBank:BQ284855 (1) 703bp
    GenBank:BM776622 (1) 676bp
    GenBank:BI983329 (1) 632bp
    GenBank:EB915864 (1) 523bp
    GenBank:AW019282 (1) 432bp
    GenBank:CD605152 (1) 296bp
    CITATIONS (1)