ZFIN ID: ZDB-TSCRIPT-091110-293
Transcript Name: lman1-002
Previous Name: dkeyp-79c2.1-006

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000043615 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000043615|OTTDARG00000018936|ZDB-GENE-060201-4 lman1|OTTDARP00000034576 lman1-002 LG_none CU694483.6,BX248399.5 Danio rerio protein_coding KNOWN, 300 bp
ATGACGTTCTGTCATTTTTGCTGTTCAGGCTTACAGAACC
TGGGCAGAATCTGCCTCCCCCAGAAAAAGAGATTCCCAAA
GAGGAGAAGGACAAGTACCAGGAGGAGGCAGTTGAGGACC
TGTATGAAAGCGTTAACGATCGGGAAATCCGTCAGGTGTT
TGAGGGGCAGAATCGAATTCACCTGGAGATCAAGCAGTTG
AACAGGCAGCTGGCAATGATTCTGGACGAACAGCGGCGTT
ATGTGTCAGTCATCACAGACGAGATCAACAAACGCACCTC
ACAAGCACAGTCTGGACAGG

lman1 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA lman1-001 (1) 2104
lman1-002 300
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
lman1-002 Contained in:
OTHER lman1-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000043615 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CT701252 (1) 497bp
    CITATIONS (1)