ZFIN ID: ZDB-TSCRIPT-090929-6279
Transcript Name: abhd10a-003
Previous Name: abhd10-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000023066 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000023066|OTTDARG00000018887|ZDB-GENE-060526-144 abhd10a|no_translation CH211-271B14.3-003 LG_ CU861887.12 Danio rerio protein_coding NOVEL, 794 bp
GGGACAGTATGGCATCAGTGGTGTTCAGACATTGCTCAAA
TGTTCTTAAAATAAGCCTCCGGAAATCCACAGCTCTCCCG
CACATTTTAACGGGTGTTCGGCACAAGACCACAATTCAGT
ATGCAACACGAGCCGATCTGCCAAAGCTGGCCTACAGAAA
GCTGAAAGGGAAGAGTCCTGGTGTGGTTTTCTTGCCCGGT
TTCGCCTCACACATGGGTGGACAGAAAGCAGAAGCATTAG
AGGAGTTCTGCAAGTCTTTAGGGCACTCGTGCCTGAGGTA
ATCACTAGAGGCGCTAAAAGCCTTGTAGTTCTTTTAACTT
TGTGCACAAAGTCTTTTTCCAGTACTTTCAGTCTCTCTGT
TCCTATATGGTGAAATGATCTGCCAACCTCCAGCTGAACT
GCTGAGACCACCACATCTTTTACAAAGCAAATCCAAGAAG
AAGCGCCACTTCCACAAGCATTTAATGGGATTGTTCACCC
AAAAATTACAATTTTCCTCATCATTTGTTTTTCCTCATGT
GGTTTCTTTCTTCTGTTAAACACAAAAGAAGATTTTTGGA
AACATGCTGCTTGCTGGCATCCATTGACTTCCATCGTTTG
GAAAAAAGTTTATGTGATAGTCAGTAGCTATGATTTCATC
CAAAGATGCAAATTAGATTTGAATACTAGCATATCTGTTT
TTATTAAATTAATTGTAAGATGTTTCCGGCCTTACCCGCA
TTCATCTTGTCTCAGGCATTAGGTTCCATGGGTCTCTAGC
AATGACTGTAAAAAATATGGACGACGCGACAGCC

abhd10a TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA abhd10a-201 (1)    Ensembl 4046
ncRNA abhd10a-002 (1)    Ensembl 740
abhd10a-003 794
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
abhd10a-003 Contained in:

Genome Resources: Vega_Trans:OTTDART00000023066 (1),  Ensembl_Trans:ENSDART00000166142 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CK141455 (1) 791 nt
CITATIONS (2)