Transcript

abhd10a-003

ID
ZDB-TSCRIPT-090929-6279
Name
abhd10a-003
Previous Names
  • abhd10-003
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000023066 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000023066|OTTDARG00000018887|ZDB-GENE-060526-144 abhd10a|no_translation CH211-271B14.3-003 LG_ CU861887.12 Danio rerio protein_coding NOVEL, 794 bp
GGGACAGTATGGCATCAGTGGTGTTCAGACATTGCTCAAA
TGTTCTTAAAATAAGCCTCCGGAAATCCACAGCTCTCCCG
CACATTTTAACGGGTGTTCGGCACAAGACCACAATTCAGT
ATGCAACACGAGCCGATCTGCCAAAGCTGGCCTACAGAAA
GCTGAAAGGGAAGAGTCCTGGTGTGGTTTTCTTGCCCGGT
TTCGCCTCACACATGGGTGGACAGAAAGCAGAAGCATTAG
AGGAGTTCTGCAAGTCTTTAGGGCACTCGTGCCTGAGGTA
ATCACTAGAGGCGCTAAAAGCCTTGTAGTTCTTTTAACTT
TGTGCACAAAGTCTTTTTCCAGTACTTTCAGTCTCTCTGT
TCCTATATGGTGAAATGATCTGCCAACCTCCAGCTGAACT
GCTGAGACCACCACATCTTTTACAAAGCAAATCCAAGAAG
AAGCGCCACTTCCACAAGCATTTAATGGGATTGTTCACCC
AAAAATTACAATTTTCCTCATCATTTGTTTTTCCTCATGT
GGTTTCTTTCTTCTGTTAAACACAAAAGAAGATTTTTGGA
AACATGCTGCTTGCTGGCATCCATTGACTTCCATCGTTTG
GAAAAAAGTTTATGTGATAGTCAGTAGCTATGATTTCATC
CAAAGATGCAAATTAGATTTGAATACTAGCATATCTGTTT
TTATTAAATTAATTGTAAGATGTTTCCGGCCTTACCCGCA
TTCATCTTGTCTCAGGCATTAGGTTCCATGGGTCTCTAGC
AATGACTGTAAAAAATATGGACGACGCGACAGCC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations