Transcript

abhd10a-201

ID
ZDB-TSCRIPT-090929-6277
Name
abhd10a-201
Previous Names
  • abhd10-001
  • abhd10a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000023064 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000023064|OTTDARG00000018887|ZDB-GENE-060526-144 abhd10a|OTTDARP00000019215 CH211-271B14.3-001 LG_ CU861887.12 Danio rerio protein_coding NOVEL, 4046 bp
GGCTAATCAAACACCATGGAGGTTTCACTAGCATTGTAAC
ATAAAGCTCATGCGTTGATGTAATTTGTCGTTTTTTAGTT
AGAAATTTAAGCTTAAACTCTGAATAGAGAGAAAATAGTA
ACAAAAAGAGGAAAATACAATAACCTGCAGTAATATTAGG
AATAACCTGCAATGGATATGGCTGACACACCAGAGGAGAA
ATCGTTTGTTTTGGATCTCTTATCTAAACGACATCAGCTA
CAACTGTCAGGTGTTCGGCACAAGACCACAATTCAGTATG
CAACACGAGCCGATCTGCCAAAGCTGGCCTACAGAAAGCT
GAAAGGGAAGAGTCCTGGTGTGGTTTTCTTGCCCGGTTTC
GCCTCACACATGGGTGGACAGAAAGCAGAAGCATTAGAGG
AGTTCTGCAAGTCTTTAGGGCACTCGTGCCTGAGGTTTGA
CTATTCTGGCTGTGGATCATCTGAGGGCGAATTGACGAAC
TACACTATTGGAGCCTGGAAGAAGGATGTGCTCTATGTGC
TGGATGAGCTAGTAGAAGGCCCACAGATTCTGGTGGGCTC
CAGCATGGGTGGGTGGTTGATGCTGCTGGCTGCTCTTGCA
CGTCCTGAGAAAACAGCTGCTTTAGTGGGCATCTCAACAG
CTGCGGATCACTTCGTCACAGCCTTCAACGCACTACCTAT
AGAGACAAAGAAGGAGATAGAGGAACAGGGCTTCTGGAAG
TTCCCCACTAAGCACAATGAAGAAGGTTTCTACACCCTGA
GCCTGGACTTTCTGAAGGAGGCGGAAAACCATTGCATCCT
CCACAGCCCTATCCCCGTCTCCTGTCCTGTACGGCTGGTT
CACGGCCTCAAAGACTCAGATGTGCCCTGGCATGTGTCCA
TGCAGGTGGCAGAACGGGTACTCAGCAATGATGTGGATGT
CGTTCTGCGCAAACATGGCCAGCATCGCATGTCTGAGAAA
GAAGACATCAAGCTCATGGTGTACACTATTGATGACCTTA
TCGATAAATTGACTACACTGGGCTGAGAGCGGTATAACAG
ACACACCGTGATTAAGAGAGAACAGCATATACAGGTATCG
GGTTTCTGGGAAATATGGTTTGGAGGTAGGTGGTGAAGTG
AAAGAAGCCAAATCAGTTGACAGGGAAATCAACCAAAAGT
GAAACCTTTTTTATTTCATCCTAGAGCCATATTATTATTT
GTTGTTTTGTTATGGAACACTAGTTCAGTGACCAGATGCT
GACATTTTCCAGAAGTTTATTTGACTTGTCAACTATTCCT
TACATAGTCTTTTCAAGCCATATGAAAACTTTGTATACTG
TAAAAAGTGATTAGTTGACTAATTTAAAAAAGTGAGCAAA
CTGTTGCTTTTAAAGTGATTAGTTGACTTAAGTGAGTAAA
CTGCTTGCTTTTAATTTAAAAGCTACAGGTTTACTCACTT
AAGTCAACTAATCACTTTAAAAGCAAAGGGTTTACTCACT
TTAGTAAAGTTGACTAATTGCTTTAAAAGCAGCAGGTTTT
ACTTTACTAAAGTGAGTACTTTACTTTTAGTTGACTTTAC
CCAAGTGAGTAAACCTGTTGCTTTTAAAGTGATTAGTTTA
CTTAACTTAAAACGTGAGCTAGCCTGTTGCTTTTAAAGCG
ATTAGTTGACTTTACTTAAGTGAGTAAACCTGTTGCTTTT
AAAGTGATTAGTTGACTTTACTTAAGTGAGTAAACCTGTT
GCTTTAAAAGTGATTAGTTGACTTAACTTAAGTGAGTAAA
CCTGTTGCTTTTAAAGCGATTAGTTGACTTTACTTAAGTG
AGTAAACCTGTTGCTTTTAAAGCGATTAGTTGACTTTACT
TAAGTGAGAAAACCTGTTGCTTTTAAAGCGATTAGTTGAC
TTTACTTAAGTGAGTAAACCTGTTGCTTTTAAAGCGATTA
GTTGACTTTACTTAAGTGAGTAAACCTGTTGCTTTAAAAG
TGATTAGTTGACTTTACTTAAGTGAGTAAACCTGTTGCTT
TAAAAGTGATTAGTTGACTTTACTTAAGTGAGTAAACCTG
TTGCTTTAAAAGTGATTAGTTGACTTTACTTAAGTGAGTA
AACCTGTTGCTTTTAAAGCGATTGGTTGACTTGACTTAAA
ATAAGTGAGTAAACCTGTTGCTTTTAAAGCGATTAGTTGA
CTTAAGTGAGTAAACCTGTTGCTTTTAAAGCGATTTGTTG
ACTTTACCTAAGTAAGTAAACCTGTTGCTTTTAAAGCGAT
TTGTTGACTTTACCTAAGTGAGTAAACCTGTTGCTTTTAA
AGCGATTAGTTGACTTAAGGGAGTAAACCTGTTGCTTTTA
AAGCGATTAGTTGACTTTACTTAAGTGAGTAAACCTGTTG
CTTTTAAAGCAATTAGTTGACTTAACTTAAAACATGAGTT
AGCCTGTTGCTTTTAAAGCGATTAGATTACTTAACCTAAA
ACGTGAGTTAGCCTGTTGCTTTTAAAGCGATTAGATTACT
TAACCTAAAACGTGAGTTAGCCTGTTGTTTTTAAAGTGAT
TAGTTGACTTAACTTAAAACGTGAGTTAGCCTGTTGTTTT
TAAAGTGATTAGTTGACTAGTTGTTTTCAAGGCAGCAGGT
TTCCTCGCTATTTTTAACTAAAGTAACTTATCGCTTTTTA
CACTGTATAAGGGACAGGCCAAAATTGTAATCGCTGTTCC
CTAAAATCCTTCTCTGTCACCAAGCAGCCAACACTTCATA
ACCTGATGCAATGTGCCAAGTCAGAACATGCACAAGCACT
GAGGAGCTTTGACGGGCCAAGAACTGACGATTATAAATAC
ACTTCAGGAGCACTTTACTATAAGGTCTCAATTGCTAATG
CTAATTAATGCATTAGTTAATTAAAAAAAATACAACAGAT
ACAACTTTCAGTCTTACAAATCTATCAGTAAAAGTGCAGA
TTAAAGGGCCAGTTCACCCTAAAATGAAACTTTACAGTTA
ATTTACTGACATAGATGATCGATTCTGTTTCATAAGTGTA
TAGCCAAAGGGATTGATTTCTACTTGCTTGTATATGTTTA
TTTTTCATTTTAAAAACCGGGCAACTATAGACTTAATAAG
AATCACCACAGATTCATCTAAAAACCTTCTTTAATGTTCC
AGTGAGCCAAATACTATCCGTCTAACTTAATTGCGGTAGA
TGTATTGGTCATGTTAACTAATGCTAGCAAACGGGACCTT
ATTGTGAAGTGTTGCTCTAAAATTTCAAAATAAAAGTTAT
AAACCTTTGTTATGCATCCAAACTATGCATGTCTTGCATT
GATTCTTAGCACTGGCTCCTATTATGCAATGATCATTCTT
AATATTCAATTACATGTAGGGCCTTATTTTGTCCCCAAAG
TTTTGTACTTAGTCTTATTTTCCATTGATTGAGGGTTTGA
CTGTGTTAAACAGTAGTTTTTTAGTGTCTCTATATTATTT
AATCCCTTCCAGGAGAAACTTACCTCTGATTTTATTTATC
ACTGATTTCTAGTCTTTTTAACGATGGTAGGAGTTTAAAA
AGTATGTATATTCCCTAATATGTGGATTACTCTTCACATT
TGAGCTCTCCATGTTGGGCAGATTTTATATTTATTATTTC
GTTAATTGTCCCCTGGTGTGTTTTCTTTTTGTTTTAGCAC
CTGGTTTCTCCTCTTGACACATAGATAAATACTATATATA
TATTTTTTGATCTCTGTTTGAGTGTTTTTATACCACCAAC
TGTGCTTTTATATTTGTTTGTTGTCAGTATCCACCCACTG
ACGGTGATTTATGTCGTGACAAAAGTTGTCTTCCGCATAA
TTTGTAAGTTATTCCCACAGGGTGATTACAGCATGCATTG
TTACACTTTTATTCTCTTGTCAGCGGTATGTATGTTTATA
TATTATTTATATCATTTATCATGCACATGTTGCTGTGCAC
CACATTTATGTTAGTTCATAATAGACATTTAAATATGTAA
AAAATATATAAACGTATGGTCTGTTTGTCAGATATGTATA
AATCTATGTAATAAAGAACTTTTTGTTTATTAAAGTGGAC
AGTAGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations