ZFIN ID: ZDB-TSCRIPT-090929-6277
Transcript Name: abhd10a-201
Previous Names: abhd10-001, abhd10a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000023064 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000023064|OTTDARG00000018887|ZDB-GENE-060526-144 abhd10a|OTTDARP00000019215 CH211-271B14.3-001 LG_ CU861887.12 Danio rerio protein_coding NOVEL, 4046 bp
GGCTAATCAAACACCATGGAGGTTTCACTAGCATTGTAAC
ATAAAGCTCATGCGTTGATGTAATTTGTCGTTTTTTAGTT
AGAAATTTAAGCTTAAACTCTGAATAGAGAGAAAATAGTA
ACAAAAAGAGGAAAATACAATAACCTGCAGTAATATTAGG
AATAACCTGCAATGGATATGGCTGACACACCAGAGGAGAA
ATCGTTTGTTTTGGATCTCTTATCTAAACGACATCAGCTA
CAACTGTCAGGTGTTCGGCACAAGACCACAATTCAGTATG
CAACACGAGCCGATCTGCCAAAGCTGGCCTACAGAAAGCT
GAAAGGGAAGAGTCCTGGTGTGGTTTTCTTGCCCGGTTTC
GCCTCACACATGGGTGGACAGAAAGCAGAAGCATTAGAGG
AGTTCTGCAAGTCTTTAGGGCACTCGTGCCTGAGGTTTGA
CTATTCTGGCTGTGGATCATCTGAGGGCGAATTGACGAAC
TACACTATTGGAGCCTGGAAGAAGGATGTGCTCTATGTGC
TGGATGAGCTAGTAGAAGGCCCACAGATTCTGGTGGGCTC
CAGCATGGGTGGGTGGTTGATGCTGCTGGCTGCTCTTGCA
CGTCCTGAGAAAACAGCTGCTTTAGTGGGCATCTCAACAG
CTGCGGATCACTTCGTCACAGCCTTCAACGCACTACCTAT
AGAGACAAAGAAGGAGATAGAGGAACAGGGCTTCTGGAAG
TTCCCCACTAAGCACAATGAAGAAGGTTTCTACACCCTGA
GCCTGGACTTTCTGAAGGAGGCGGAAAACCATTGCATCCT
CCACAGCCCTATCCCCGTCTCCTGTCCTGTACGGCTGGTT
CACGGCCTCAAAGACTCAGATGTGCCCTGGCATGTGTCCA
TGCAGGTGGCAGAACGGGTACTCAGCAATGATGTGGATGT
CGTTCTGCGCAAACATGGCCAGCATCGCATGTCTGAGAAA
GAAGACATCAAGCTCATGGTGTACACTATTGATGACCTTA
TCGATAAATTGACTACACTGGGCTGAGAGCGGTATAACAG
ACACACCGTGATTAAGAGAGAACAGCATATACAGGTATCG
GGTTTCTGGGAAATATGGTTTGGAGGTAGGTGGTGAAGTG
AAAGAAGCCAAATCAGTTGACAGGGAAATCAACCAAAAGT
GAAACCTTTTTTATTTCATCCTAGAGCCATATTATTATTT
GTTGTTTTGTTATGGAACACTAGTTCAGTGACCAGATGCT
GACATTTTCCAGAAGTTTATTTGACTTGTCAACTATTCCT
TACATAGTCTTTTCAAGCCATATGAAAACTTTGTATACTG
TAAAAAGTGATTAGTTGACTAATTTAAAAAAGTGAGCAAA
CTGTTGCTTTTAAAGTGATTAGTTGACTTAAGTGAGTAAA
CTGCTTGCTTTTAATTTAAAAGCTACAGGTTTACTCACTT
AAGTCAACTAATCACTTTAAAAGCAAAGGGTTTACTCACT
TTAGTAAAGTTGACTAATTGCTTTAAAAGCAGCAGGTTTT
ACTTTACTAAAGTGAGTACTTTACTTTTAGTTGACTTTAC
CCAAGTGAGTAAACCTGTTGCTTTTAAAGTGATTAGTTTA
CTTAACTTAAAACGTGAGCTAGCCTGTTGCTTTTAAAGCG
ATTAGTTGACTTTACTTAAGTGAGTAAACCTGTTGCTTTT
AAAGTGATTAGTTGACTTTACTTAAGTGAGTAAACCTGTT
GCTTTAAAAGTGATTAGTTGACTTAACTTAAGTGAGTAAA
CCTGTTGCTTTTAAAGCGATTAGTTGACTTTACTTAAGTG
AGTAAACCTGTTGCTTTTAAAGCGATTAGTTGACTTTACT
TAAGTGAGAAAACCTGTTGCTTTTAAAGCGATTAGTTGAC
TTTACTTAAGTGAGTAAACCTGTTGCTTTTAAAGCGATTA
GTTGACTTTACTTAAGTGAGTAAACCTGTTGCTTTAAAAG
TGATTAGTTGACTTTACTTAAGTGAGTAAACCTGTTGCTT
TAAAAGTGATTAGTTGACTTTACTTAAGTGAGTAAACCTG
TTGCTTTAAAAGTGATTAGTTGACTTTACTTAAGTGAGTA
AACCTGTTGCTTTTAAAGCGATTGGTTGACTTGACTTAAA
ATAAGTGAGTAAACCTGTTGCTTTTAAAGCGATTAGTTGA
CTTAAGTGAGTAAACCTGTTGCTTTTAAAGCGATTTGTTG
ACTTTACCTAAGTAAGTAAACCTGTTGCTTTTAAAGCGAT
TTGTTGACTTTACCTAAGTGAGTAAACCTGTTGCTTTTAA
AGCGATTAGTTGACTTAAGGGAGTAAACCTGTTGCTTTTA
AAGCGATTAGTTGACTTTACTTAAGTGAGTAAACCTGTTG
CTTTTAAAGCAATTAGTTGACTTAACTTAAAACATGAGTT
AGCCTGTTGCTTTTAAAGCGATTAGATTACTTAACCTAAA
ACGTGAGTTAGCCTGTTGCTTTTAAAGCGATTAGATTACT
TAACCTAAAACGTGAGTTAGCCTGTTGTTTTTAAAGTGAT
TAGTTGACTTAACTTAAAACGTGAGTTAGCCTGTTGTTTT
TAAAGTGATTAGTTGACTAGTTGTTTTCAAGGCAGCAGGT
TTCCTCGCTATTTTTAACTAAAGTAACTTATCGCTTTTTA
CACTGTATAAGGGACAGGCCAAAATTGTAATCGCTGTTCC
CTAAAATCCTTCTCTGTCACCAAGCAGCCAACACTTCATA
ACCTGATGCAATGTGCCAAGTCAGAACATGCACAAGCACT
GAGGAGCTTTGACGGGCCAAGAACTGACGATTATAAATAC
ACTTCAGGAGCACTTTACTATAAGGTCTCAATTGCTAATG
CTAATTAATGCATTAGTTAATTAAAAAAAATACAACAGAT
ACAACTTTCAGTCTTACAAATCTATCAGTAAAAGTGCAGA
TTAAAGGGCCAGTTCACCCTAAAATGAAACTTTACAGTTA
ATTTACTGACATAGATGATCGATTCTGTTTCATAAGTGTA
TAGCCAAAGGGATTGATTTCTACTTGCTTGTATATGTTTA
TTTTTCATTTTAAAAACCGGGCAACTATAGACTTAATAAG
AATCACCACAGATTCATCTAAAAACCTTCTTTAATGTTCC
AGTGAGCCAAATACTATCCGTCTAACTTAATTGCGGTAGA
TGTATTGGTCATGTTAACTAATGCTAGCAAACGGGACCTT
ATTGTGAAGTGTTGCTCTAAAATTTCAAAATAAAAGTTAT
AAACCTTTGTTATGCATCCAAACTATGCATGTCTTGCATT
GATTCTTAGCACTGGCTCCTATTATGCAATGATCATTCTT
AATATTCAATTACATGTAGGGCCTTATTTTGTCCCCAAAG
TTTTGTACTTAGTCTTATTTTCCATTGATTGAGGGTTTGA
CTGTGTTAAACAGTAGTTTTTTAGTGTCTCTATATTATTT
AATCCCTTCCAGGAGAAACTTACCTCTGATTTTATTTATC
ACTGATTTCTAGTCTTTTTAACGATGGTAGGAGTTTAAAA
AGTATGTATATTCCCTAATATGTGGATTACTCTTCACATT
TGAGCTCTCCATGTTGGGCAGATTTTATATTTATTATTTC
GTTAATTGTCCCCTGGTGTGTTTTCTTTTTGTTTTAGCAC
CTGGTTTCTCCTCTTGACACATAGATAAATACTATATATA
TATTTTTTGATCTCTGTTTGAGTGTTTTTATACCACCAAC
TGTGCTTTTATATTTGTTTGTTGTCAGTATCCACCCACTG
ACGGTGATTTATGTCGTGACAAAAGTTGTCTTCCGCATAA
TTTGTAAGTTATTCCCACAGGGTGATTACAGCATGCATTG
TTACACTTTTATTCTCTTGTCAGCGGTATGTATGTTTATA
TATTATTTATATCATTTATCATGCACATGTTGCTGTGCAC
CACATTTATGTTAGTTCATAATAGACATTTAAATATGTAA
AAAATATATAAACGTATGGTCTGTTTGTCAGATATGTATA
AATCTATGTAATAAAGAACTTTTTGTTTATTAAAGTGGAC
AGTAGG

abhd10a TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA abhd10a-201 4046
ncRNA abhd10a-002 (1)    Ensembl 740
abhd10a-003 (1)    Ensembl 794
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
abhd10a-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000023064 (1),  Ensembl_Trans:ENSDART00000158917 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CN014044 (1) 942 nt
GenBank:CV482916 (1) 784 nt
CITATIONS (2)