Transcript

abhd10a-002

ID
ZDB-TSCRIPT-090929-6278
Name
abhd10a-002
Previous Names
  • abhd10-002
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000023065 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000023065|OTTDARG00000018887|ZDB-GENE-060526-144 abhd10a|no_translation CH211-271B14.3-002 LG_ CU861887.12 Danio rerio protein_coding NOVEL, 740 bp
ACTGGAGGCTTGTGTGTCAACGTTAGCGTCTCCGCAGACA
GCGGGACAGTATGGCATCAGTGGTGTTCAGACATTGCTCA
AATGTTCTTAAAATAAGCCTCCGGAAATCCACAGCTCTCC
CGCACATTTTAACGGGTGTTCGGCACAAGACCACAATTCA
GTATGCAACACGAGCCGATCTGCCAAAGCTGGCCTACAGA
AAGCTGAAAGGGAAGAGTCCTGGTGTGGTTTTCTTGCCCG
GTTTCGCCTCACACATGGGTGGACAGAAAGCAGAAGCATT
AGAGGAGTTCTGCAAGTCTTTAGGGCACTCGTGCCTGAGG
TTTGACTATTCTGGCTGTGGATCATCTGAGGGCGAATTGA
CGAACTACACTATTGGAGCCTGGAAGAAGGATGTGCTCTA
TGTGCTGGATGAGCTAGTAGAAGGCCCACAGATTCTGGTG
GGCTCCAGCATGGGTGGGTGGTTGATGCTGCTGGCTGCTC
TTGCACGTCCTGAGAAAACAGCTGCTTTAGTGGGCATCTC
AACAGCTGCGGATCACTTCGTCACAGCCTTCAACGCACTA
CCTATAGAGGTACGAAAGCCTTCAAAGTCAGATCAAATGA
TTAAAGCAAGTCCGTTTGTTGGGGTTTTAATACAAACTGT
GTATATTGTAAGTATAACAAATTACTCTTACTGTCGCTCA
TACTTTTACACTTGTGGAATTTACATGAGAACTAGAAAAC
AATGTTTGAGGCTCATGACA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations