ZFIN ID: ZDB-TSCRIPT-090929-5420
Transcript Name: sik1-003
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000021919 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000021919|OTTDARG00000011701|ZDB-GENE-030131-9446 sik1|no_translation CH211-235E18.3-003 LG_ BX537313.5 Danio rerio protein_coding NOVEL, 606 bp
CAGTTGTAGGGGATTTTTCCTCTCTTCTCATCTCCGGTAC
TGGACCTGGGGCCTTAGGCCCTGCTGGGACACCCCTTGCT
CTTTCCTCCAACTTGCTTTTGCAGAACCAAGGGAGCATGC
TTGCAGCCAGCTTCCAAGAGGGCCGTAGAGCATCAGATAC
CTCCCTTACACAGGGTGAGATTTTTACTTCAAAGACACAG
TTAATACAATCAACTCACAGACTTATTATAGACCAAATAT
CTAAATTGGTTCTGACCAGTCTGTGAAAATTTCTTTAGGT
CTAAAAGCATTCAGACAGCAGCTGAGGAAGAACACTCGTG
CGAAAGGCTTACTGGGGTTAAACAAAATCAAAGGTTTGGC
CCGACAAGTGTGCCCACCGTCTTCATGCTCCAGAGGCAGC
CGAGGGTCGCTTGGTCCAACTATGTGCCCTCCCTCAAGCC
TCCAGAGTTCTAGTGGGCCCCGTGAACGCCGTAGCATGTT
GGAGGAAGTTCTGCACCAGCAGAGAATGCTGCAGATTCAG
CACCAGCCTCAACCCCAAGTCCAATTTCTCTCACAGTCTC
ACCCTTCATCTCCTCCCTCCAACAATCTCTTTGCTCCTGC
TGCTCT

sik1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA sik1-201 (1)    Ensembl 4880
ncRNA sik1-002 (1)    Ensembl 539
sik1-003 606
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
sik1-003 Contained in:
[BAC] CH211-235E18 (1)

Genome Resources: Vega_Trans:OTTDART00000021919 (1),  Ensembl_Trans:ENSDART00000130522 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:DN898897 (1) 605 nt
CITATIONS (2)