Transcript

sik1-002

ID
ZDB-TSCRIPT-090929-5419
Name
sik1-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000021918 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000021918|OTTDARG00000011701|ZDB-GENE-030131-9446 sik1|no_translation CH211-235E18.3-002 LG_ BX537313.5 Danio rerio protein_coding NOVEL, 539 bp
GAACCCGTCTTGGGTATCATGCAGACCCTTGGCATTGACC
GGCAGAGGACTGTGGAGTCTCTCCAGAACAGCAGCTACAA
TCACTTCTCAGCTATCTATTACCTGCTGCTCGAAAGAGTG
AAGGAGCACCGCAGCCAACAGATTAGCCGTCAATGTGGGG
CCTGGAATCAGAGGTCGAGGACAGCGTCTGATTCCTCCAC
CCCAGAGGTGATCATGGAGTCATCTGACAGCTTCAGAAAC
TCTGCCTTCCCTGTCGCCACCAAGGTGAATGCTCCTATCC
ATTCAGAGATGGAATGTGAACAAGGAGGTCTATTTCAGAT
ATGCAGTGCTCCCCCAATCCCCCTCCTCCATTAGAGACAG
GCAGTGGCTAATGTGAATGCCTCCCTCCCTTCCTCAGCGC
GTGGTGTGCCCAGTGGAAGCCAGCCTGAATGGACTCCTGT
GGAACAGATCTATCTCCCCAAACAGCCTGCTGGAGACCAC
CATTAGCGAGGAGGTGCGACCTCATGACCTAGAGGAAGAA
GAGGGTATCCTGCAGGTTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations