ZFIN ID: ZDB-TSCRIPT-090929-5372
Transcript Name: cnot6l-201
Previous Name: cnot6l-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000021807 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000021807|OTTDARG00000018045|ZDB-GENE-050522-302 cnot6l|OTTDARP00000018338 DKEY-58F10.2-001 LG_ BX640512.4 Danio rerio protein_coding KNOWN, 2613 bp
AGTTGTAGGGGAGCGTGGACCGGAGCGGAAGCTCAGACTG
TTGTCCTTCCTCCTGCCCGACTCTCAGGATGAGGATCGGT
CACAGTTTGTCTGTATGTCTCTGATTAAATCACACACCAG
CAGCTCCTCTCCCACCTCCCGAATGCAGATTAACAGGCAT
GCCAAAGGAAAAATATGATCCTCCAGACCCACGCAGATTA
TACACCATCATGTCAGCCGAGGAAGTGGCCAGTGGAAAGA
AATCACACTGGACCGAGTTGGAGATTTCTGGGCGGGTCAG
AAGCCTGAGCAGTTCACTATGGACGCTGACCCATCTGACT
GCTCTCCACATCAACAACAACAACCTGAGCCGGATTCCTC
CAGAAATCGCAAAGCTGCCCCATCTCGTCTACCTGAACCT
GTCCTCCAACAAACTGCGCAGCCTGCCAGCAGAACTCGGC
AACATGGTGACTCTCAGGGAATTGCTTTTGAATAACAATT
GTTTACGAGTTTTGCCTTATGAACTTGGTCGGCTGTTCCA
ATTGCAAACCCTCGGCCTCAAAGGTAATCCATTGTCCCAG
GATATACTCAACCTGTATCAGGAGCCTGATGGAACAAGGA
AATTATTAAATTACATGCTCGACAATCTTGCAGTCCACCC
AGAACAACTCCCCCAAAGACCTTGGATCACTCTGAGGGAG
AGAGACCAAATGATGCCCACAGCTGTGTTCACAGTAATGT
GCTACAATGTATTGTGCGACAAGTATGCAACAAGGCAGCT
GTATGGCTATTGTCCTTCATGGGCCCTTAACTGGGAGTAC
AGGAAGAAGGGCATTATGGAGGAGATCACCAACTGTGACG
CTGACATCATCAGCCTGCAGGAGGTGGAAACCGAGCAGTA
CTACACTTTCTTTCTGGAAACACTGAAAGATCGTGGATAT
GATGGATTTTTCTGTCCAAAGTCTCGTGCCAAACTCGTGT
CAGAACAGGAGCGTAAACATGTGGATGGCTGTGGTGTGTT
TTTCAAGACCGAGAAATTTGCTCTGGTGCAGAAACACACA
GTGGAGTTCAATCAAGTAGCCATGGCGAACTCAGAGGGCT
CGGAGGTTATGCTAAACAGAGTTATGACCAAAGATAACAT
CGGAGTAGCCGTCCTGCTGGAGGTGAAGAAAGACCTGTTT
GCTACTGGCTTAAAGCCACCTCCAGAGAAACAGCTCCTGC
TTGTAGCTAACGCCCACATGCACTGGGATCCAGAATACTC
GGATGTGAAGCTCATCCAGACTATGATGTTCCTGTCTGAG
CTCAAGAGCATCGCTGAGAGGGCCTCGGGATCTATCAACT
CTTCTTCACCCACATCAGAAACAAGCTCTATCCCTATCGT
CCTGTGTGCTGATCTCAACTCCCTCCCAGATTCTGGTGTG
GTGGAGTATCTGAGCAATGGCGGAGTTGCAGAAAATCACA
AAGACTTTAAAGAACTGCGCTACAGCGACTGTTTAACTAA
CTTCAGCTGCAATGGCAAAAACGGCAAGCCTGATGGCAGT
ATCACACACAGTTTCCAGCTGAAGAGTGCCTATGAGGGGA
ATCTCATGCCCTACACCAACTACACTTATGACTTCAAGGG
TGTGATTGACTACATCTTCTTCTCAAAGACACACATGAGC
GTTCTGGGTGTTCTGGGTCCATTGGAGACACAATGGCTGA
AGGACAACAACATAACCGGCTGCCCTCACCCTCACATCCC
CTCCGACCACTTCTCCCTCCTGGCTCAGCTGGAGTACCAT
CCGCCTTTACCCCCCCTCAACGGGCTGCATCTGCCTGTCC
ACAGTACTGCCTGCGAAAGCAAGATGCTTACAGAGTGAAC
CAGCACCAGCATTCATCCATCCACTCATCCTTCCATCCAT
CCATCCATCCATCCATTTCTTCACCAGAGAGGCATGATGA
CTACTAAATGGCCATGATTCAGTTATAACGTTCTTATAAA
GAAAAGATGTCATGGTCAGCAATGTTCAAATGAATTGTTA
ATGAAATTGCTAAATATCTGAGGAATGTAAATTGGCAGTT
TCCCTTGTTTAATAGCAGCAATTTTGATTTCTAAGGTTTT
TTTTAATACATTTTAAAAACCTTTCATGTAATCCTAACAA
AAATTCACATCAAAGCATATTTCCTACAAATGTATTCCGA
GTGCTCAGATTAAAATCCAGATTGCTGAACATGCAGTGTT
TGTATAATAATATATATAGTTTAATATATAGTAAAAGCAT
GCACTATGGGGGTTGAGTCTTGTTGAGACACTCTAATTAA
TGACAGACATGTATTATTGTAAAGGAACATTTTGCAAAGA
GACCCCATGTACAATGAATAGAAAACCCCTATAAAAAAGA
AGTTCCACAACACAAAGATGGCTTTTCTCATTGACTTTTG
AGACTTTTTTCATGCAGTTTCTTCTGGAATACATGTTTTG
TAAACCTTGTTTAGTCTTTGAACACATGATTGGTGATGAT
ATGAGAACAGAACTTGTTGTTGTGTGCGTTTTGCAACTGA
AAATGCTCCTTCATGAAGCTTATTTGTAATACACTAAATA
CTCAACAAAAAAACTTGTCCCAAACTCAAAGGCAATAAAG
ATGTTATTTTAAA

cnot6l TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA cnot6l-201 2613
ncRNA cnot6l-002 (1)    Ensembl 594
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cnot6l-201 Contained in:
[BAC] DKEY-58F10 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000021807 (1),  Ensembl_Trans:ENSDART00000076807 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC095634 (1) 2624 nt
GenBank:DR718696 (1) 844 nt
GenBank:CA472314 (1) 837 nt
GenBank:CD758369 (1) 822 nt
GenBank:CO798038 (1) 815 nt
GenBank:CN180209 (1) 776 nt
GenBank:CN331897 (1) 750 nt
GenBank:CK705438 (1) 725 nt
GenBank:CO357236 (1) 599 nt
GenBank:AW420063 (1) 445 nt
GenBank:BQ419209 (1) 440 nt
CITATIONS (2)