ZFIN ID: ZDB-TSCRIPT-090929-5373
Transcript Name: cnot6l-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000021808 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000021808|OTTDARG00000018045|ZDB-GENE-050522-302 cnot6l|no_translation DKEY-58F10.2-002 LG_ BX640512.4 Danio rerio protein_coding KNOWN, 594 bp
CAGCTCCTCTCCCACCTCCCGAATGCAGATTAACAGGCAT
GCCAAAGGAAAAATATGATCCTCCAGACCCACGCAGATTA
TACACCATCATGTCAGCCGAGGAAGTGGCCAGTGGAAAGA
AATCACACTGGACCGAGTTGGAGATTTCTGGGCGGGTCAG
AAGCCTGAGCAGTTCACTATGGACGCTGACCCATCTGACT
GCTCTCCACATCAACAACAACAACCTGAGCCGGATTCCTC
CAGAAATCGCAAAGCTGCCCCATCTCGTCTACCTGAACCT
GTCCTCCAACAAACTGCGCAGCCTGCCAGCAGAACTCGGC
AACATGGTGACTCTCAGGTAATCCATTGTCCCAGGATATA
CTCAACCTGTATCAGGAGCCTGATGGAACAAGGAAATTAT
TAAATTACATGCTCGACAATCTTGCAGTCCACCCAGAACA
ACTCCCCCAAAGACCTTGGATCACTCTGAGGGAGAGAGAC
CAAATGATGCCCACAGCTGTGTTCACAGTAATGTGCTACA
ATGTATTGTGCGACAAGTATGCAACAAGGCAGCTGTATGG
CTATTGTCCTTCATGGGCCCTTAACTGGGAGTAC

cnot6l TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA cnot6l-201 (1)    Ensembl 2613
ncRNA cnot6l-002 594
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cnot6l-002 Contained in:
[BAC] DKEY-58F10 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000021808 (1),  Ensembl_Trans:ENSDART00000147121 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BG738234 (1) 594 nt
CITATIONS (2)