Transcript

rx1-201

ID
ZDB-TSCRIPT-090929-5096
Name
rx1-201
Previous Names
  • rx1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000021413 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000021413|OTTDARG00000017768|ZDB-GENE-990415-236 rx1|OTTDARP00000018032 rx1-001 LG_ CR936300.18 Danio rerio protein_coding KNOWN, 2884 bp
CACACACACACCAGCAGTCTGTCCAGCGGAATCCACTGGA
GAACTTCTTCTGCGCGACTGTATATGTTTTCATGTTTAAA
GTGAGAGCGGTGGAGGTCAGTCGGGAGCGTACAGTAGCAG
ACGGAGGCGTGCTCAACACCCGCATGTGACCCATTGCTTA
GGGAGAAACAGGTGGATGCAGGTCAGATTGGAGACGGAGA
GCAAACGGAGCATCTCCTGCCAGAGGTAAAACAGGCCCGT
TTTGGATTCCTCCAACAGACATCAAGTTGGTTTTATCAAT
CGGAAGGCCTTATCCCAGCAATCGAATGCATTTGTCACTG
GACACCATGAACATGGTGGATGACAGCTGTCTTTCGCCCA
GTAATTTCCATGATATGGTCAAAGCTGGGGGCGCAGTGGT
TGGCACTCGTGTCCACAGCATAGATGTGATCCTGGGCTTC
AACAAGGACCAGGATTCGTTGCTCAACCCTGGAGCCAATG
CTGTAGCACACAAAGTTGGAGGGGAGAGTCTTGGAGAACC
AGGAAAGCTGGACCAACGGGTTCAACCTTACGGACATCTG
CCACCCCTTAGGGATGGATCGGAGCAACCTACATTTCACG
ATGCCGACATGTTCTCCAACAAATGTGATGGGGACCTGGG
GGACCTGCGGAAAGCCATCGAGAGTGACAGCAAGTCTCCG
GATTCAGCCGATGGGGAGCAGCCCAAAAAAAAGCACCGCC
GCAACCGCACCACCTTCACCACATACCAGCTCCATGAGCT
TGAGCGAGCCTTCGAGAAGTCACACTACCCTGACGTTTAC
AGTCGTGAAGAGCTAGCCATGAAAGTCAATCTTCCTGAAG
TTCGAGTGCAGGTTTGGTTCCAGAATCGCAGAGCCAAATG
GAGGCGTCAGGAAAAAATAGACGCGAGCACCATGAAGCTC
CATGACTCCCCCATGCTCTCCTTCAACCGCCCGTCCATGC
ACCCCACCGTGGGGCCCATGAACAACTCGCTACCCCTCGA
CCCTTGGCTGCCCTCGCCTCTATCCAGTGCCACTCCAGTG
CACAGCATCCCAGGGTTCATGGGTCCTACACAAGGACTGC
AAACGGGCTATCCCGGTCACAGTTTCCTCAGCCCACCCCA
ACCCATGGCACAAAGCATGCAGCCCATGGCGCCACCTCCA
TACCAATGCCCTCCTCCCTTCACCGACAAATACCCTCTGG
AGGATGTAGATCAACGTAGTTCAAGCATTGCCGCACTGAG
GATGAAAGCCAAGGAGCATATCCAGTCTATGGACAAAACC
TGGCAACCCATGTGCTAAGACGTCTCTCTTTTGACTGTAA
GCCTTTGTGTTTCTGTTGTCAAATCAAGAACTTGCATCGG
ACGGTTCACTTGTTCTCTGGGTCAGAATATTTTGGGGCAG
CAAAAACAAGTTGTGCCATTATATTTATTCTTTCTGCAAC
TGGATGCAAGCTTCCGATGAAAACTGTTGAGTCTTGAGGA
TGAAACATTTACAAGCAATTCTTCATATGTCTTTTACTGC
GTTATCATTTTCAGTGGTGAGTTTGGAATATCTCAAGCGT
GTCCCTGGAGAGAATTTTCAAAACAACTTTAGAACTTTAC
ACTGTGTTTCGTTTTAGTTTACACGGCGACCCTTCAAGCT
TCAAGAGTTGCCGGTTTAAAATTTTACATATTAAACTCTG
TATTTCAAATCCCATAGATAGGACTTTACTCCTAGGAGCA
CAACAATTGCAATCCCACATGTAGGACCATACTACTCAAA
GGGTTAAACAATTTCCGAGTGGTACCAGAGTGACTGAAAT
GTGAATATGAGGGTGTGTATGGCATCACACGACCTCTGTC
TACAAATTCACACTTCTTCCCGAAGGCCTGCTCCTGATGT
TTTGGGTTGACATACAATATAAATATGGTCATTGGTTGAA
AAAAAAGGACCTCTAGGCAGCAGATTTCATGAGCAATCCC
TCGGCATGGACATGGGACAGAAACGATTAGTCTGGTGGAG
AAGTTTGTACGCCTCAGTGTGCATTAGAGGCGAATATTTT
TGGCAGATCCATCTTCTGTACGTGCGAAGGAGCAGAAGGG
GAAACTATCAGCCCCCACCCCACAATGACTTTCCCTTTGT
TTAGACCAGTTGATCCAAATCGGAACTTTTTGTTTCAACT
TCTTATAGGGATTGATGGTCAGAGAGTGTCACTCTAAGAC
ACCAATCAAAATGGATGATAGATTATATTAAACATCGGCG
CCGTGCTTTAGTGGCCTTTTGGATCACTAAGAGAATATTT
TGCAATCAAAACAGACCGTTTCATTGTCCACAAACACGCA
AGTGGGATTTGCTGCTTATTTTTTGAAAGGAAACTCACTC
AGTTCATGTTGCCAGAGTTCTGTAGCAAAATAAAATACAT
ATAGCTGTGTTTGACTAATAATGGTTCGGACCTTTAGATA
CGATTTGAGGGTGTATTAAACTTTTGAGATGGTTGAATTG
TTGAACAAACTATGCTTACTAATGATTGTCTTAGTTTTGT
ACGGATGTTGAGAACGAGAGTTTATAGATGTTATGATTTT
ATACAGTTGATCAAACTGTACATTTCAGTTATTTTTCATT
TAATGTCGTTTTACACAGTTCTGATATTGAGACCTTTGGG
CCATACATTAATTTACAAACTGCATCTATGATGTTTAGGT
AATTTGCACAGTTTGAACAACTGAAAAGCCAAAGTAAGAC
AGCAATATGACAATCACGGGCAAAAAATATGCGTATATGA
TCTTATTTTTGTCGAAAAAAAAAAAAAAGAATGTGGTTTT
TATGTTTGTAATGTGTCCTAGACGTTTTCACAGTTGACTT
TAAAACAAAATGTTCTTAAAAATAAACAAATCTAGTTTCT
CAGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations