Transcript

rx1-002

ID
ZDB-TSCRIPT-090929-13582
Name
rx1-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000032002 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000032002|OTTDARG00000017768|ZDB-GENE-990415-236 rx1|no_translation rx1-002 LG_ CR936300.18 Danio rerio protein_coding KNOWN, 938 bp
ATGTTTAAAGTGAGAGCGGTGGAGGTCAGTCGGGAGCGTA
CAGTAGCAGACGGAGGCGTGCTCAACACCCGCATGTGACC
CATTGCTTAGGGAGAAACAGGTGGATGCAGGTCAGATTGG
AGACGGAGAGCAAACGGAGCATCTCCTGCCAGAGGTAAAA
CAGGCCCGTTTTGGATTCCTCCAACAGACATCAAGTTGGT
TTTATCAATCGGAAGGCCTTATCCCAGCAATCGAATGCAT
TTGTCACTGGACACCATGAACATGGTGGATGACAGCTGTC
TTTCGCCCAGTAATTTCCATGATATGGTCAAAGCTGGGGG
CGCAGTGGTTGGCACTCGTGTCCACAGCATAGATGTGATC
CTGGGCTTCAACAAGGACCAGGATTCGTTGCTCAACCCTG
GAGCCAATGCTGTAGCACACAAAGTTGGAGGGGAGAGTCT
TGGAGAACCAGGAAAGCTGGACCAACGGGTTCAACCTTAC
GGACATCTGCCACCCCTTAGGGATGGATCGGAGCAACCTA
CATTTCACGGTAAGTCCTTCATGGAAGTCTTGTTGAGATG
TAAGTTGTGTTCACTGCATAAAGTTATTGCTTAGCTAACG
TTTTGGGATGGAAACACACAGTTGCTAAAATCCAGGGACT
GCACAAACATTTAAGGTAGGTTGCCAAGATGTCCCTGTTT
TCCATGGGTCATGGTAATCTTGTCTCCAATTAGAGCCATT
TTGATAAGAAAAATGTTAATCTAAAAATGTGTATTGTCCC
CATTTTTGAAACTATTATACAGTAATAACAGCAAAAACAC
AGGAATTACTTCACCTGGAAAGTTAAAATGTGAAGTTATT
GGTAATGTTACAAAAAATTACCAAGTTTTACAGAATATTT
AAAAAGGGCCTGTTCACATGTGATCTCTTCACAGCAATGT
ACTAGTATTTTTCTAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations