header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-4948
Transcript Name: sec14l8-201
Previous Name: sec14l8-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000020961 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000020961|OTTDARG00000017370|ZDB-GENE-060526-180 si:ch211-89f7.1|OTTDARP00000017660 CH211-89F7.1-001 LG_none BX957246.7,CU024871.12 Danio rerio protein_coding NOVEL, 2353 bp
ATTTCTGCTGCACTCGTGGCGACATGAGCGGAAGGGTTGG
AGATCTGAGCGTGAAGCAAGCCGAAGCTTTGGCCCAGTTT
CGGGAAAAAGTTCAGGATGTCCTGCCTCAGTGTCCTTCCC
AGAGTGACCACTTTCTGCTCAGATGGCTGAGAGCCAGAAA
CTTCAATTTACAGAAATCCGAGGCCATGCTGCGCAAGCAT
ATAGAGTTTCGGAAACACATGAAAGTTGACACCATCACAA
CCGAGTGGCAGGTGCCAGAGGTCATAGATAAGTATCTTTC
TGGTGGCATGTGTGGACACGACCGTGAAGGAAGCCCGGTC
TGGTATGATGTCATCGGGCCGCTGGACCCAAAGGGTTTGA
TGCACTCAGCCTCTAAGCAGGACTTAATCAAGTCTAAAGT
CAGGGACTGCGAGATTCTGCAGAAAGATTGTGATCGACAG
AGCGAACGGTTGGGTAGGAACATTGAATCCATTACTATGG
TCTATGACTGTGAAGGTCTGGGAATGAAGCACTTATATAA
GCCTGCTATAGAGACTTATGGAGAGGTTCTCACTATGTTT
GAAGATAATTATCCAGAGGGACTTAAGCGATTATTTGTCA
TCAAAGCACCTAAACTGTTTCCTGTGGCGTACAATCTGGT
GAAGCACTTTCTGAGCGAAGACACACGCCGTAAGGTCATC
GTCCTTGGATCAAACTGGCAGGAGGTTTTACAGAAGTACA
TCGACCCCGAGGAGCTGCCCGCATATTATGGAGGAAAACT
GACCGATCCTGATGGGGACCCCAAATGTAGAACTAGGATT
ACGTTCGGGTCAGAGATTCCCAAGTCCTACTATGTCCGAG
ACTCCATTAAAGTGGACTATGAACAGTCTGTGAGTATCGG
CCGGGGCTCGTCTCATCAGATGGAATATGAGCTTATCGCA
CCAAACTGTGCACTAAGGTGGCAGTTCTCCTGTGATGGGG
CAGATATAGGGTTTGGGGTGTATCTGAAGAAGAAGATGGG
AGAGAGGATGAAGGCTGGTGAAATGAGGGAAATTGTGCCG
AATCAGCGTTACAACGCACACCTGGTTCCTGAAGATGGCT
CACTCACCTGCCCAGAACCAGGAGTCTATGTCCTGCGATT
TGACAACACATACAGCGTCTTCCAGTCCAAAACGGTCAAA
TTTACAGTGGAGGTCCTCCTACCCAGTCAAGTCAACCAAT
CAGACAACTAGAAATGACGGAAACCAGAAAGAAGCTGCCA
ATAACTTGAGATTATAAAGAAACGTCAGCTCTTAGGCATA
ACAAACTGATCACAAATCTGTTGTTCATATTAAAGGATAA
GAGATTAATAATGCTGCTTTCATATAAACAAACTGACCAA
TCACTGCATCAAATGAACAGTGGGCTGAAATGTACATTTC
GAGATTTAAAGGGACAGTACACCCAAAAATGAAATAACAT
GTCCTCATTTACTCACACTTAAGTGGTTCTAAAATGGAGA
ATTTTTAGGGGGAAAAACATTGTGACATCCATACTAGGAA
CAAAAGTACTATGGAAGTCAATGGCTGTTTTTCCCCAGGC
ATTTTCCAACCTATCTTTATTTGTTTTCAACAGAAGATAG
AAACTCAAACTGGTTTAAAGCAAGCATAAATGATGGCAGA
ATGTATGTTTTGGGTGAACTATCACCTTAAGTCCATCGTC
CAGCAACATATCTGGATTCTGACTTCAGTGCCAGTGTAAT
TCCTTACGTTTATTTCTCTGAGATGAAGCTGTTATCACGT
ATAAATGAAGTGTTTGTCATTGAACTTATCAGTGAACTGT
GCTTTATCAAGTGTAACAAAAAATCCTAGACTGAAACCGT
CTCGGTGTATATTATTCAGCAAGATCTTACGTGCTTATCG
CTTAACTGATTTAGATAATTTAATCAATTTAATTCCTTTT
GATAATCAATTCATTTTAATAATGAGCTCTGAGTCTGTGG
AATTTGCTTCTTTTACAGTGTGATAATATGACAGAGTATA
TTGTTATTATTATAATGTTTTGCTTTTGTTATTGACGCAC
ACAAATGTGATACAGCAGAGTATGAAGTTTTTATTTGTAT
TGTTTCTAATTTAATTCACGATTGCCTTAAATTTAAAATT
AATGTCGTGAACTTTTGCTTAGTAAGGAGATGTTTTACCT
CAGGTCCTTGTGTTTACAATAACAATGTCCATATTTGATT
GCAGCAGCATTAATGTTGGGTCAGTGCATTTCTACAATGG
CCATGTTGAATTTCATGTCTCTTTTATTGATTTTGTAATA
TTGGTGTAATTTATGAGTGATGTTGTGTTGATTTTGATTA
ATTTACTAATCAAATAGAGACATTACAACAGCA

sec14l8 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA sec14l8-002 (1) 822
mRNA sec14l8-201 2353
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
sec14l8-201 Contained in:

OTHER sec14l8-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000020961 (1)
  • Ensembl_Trans:ENSDART00000083359 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CK016653 (1) 824 bp
    GenBank:CF996988 (1) 777 bp
    GenBank:DT074647 (1) 764 bp
    GenBank:EH501798 (1) 750 bp
    GenBank:CK138908 (1) 739 bp
    GenBank:DN895043 (1) 730 bp
    GenBank:CK679686 (1) 677 bp
    GenBank:CO355936 (1) 560 bp
    GenBank:AL917589 (1) 539 bp
    CITATIONS (2)