header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-13930
Transcript Name: sec14l8-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000032521 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000032521|OTTDARG00000017370|ZDB-GENE-060526-180 si:ch211-89f7.1|no_translation CH211-89F7.1-002 LG_none BX957246.7,CU024871.12 Danio rerio protein_coding NOVEL, 822 bp
TTGAGCTCAAAATGTAGTCTAATAACCCTGTATGTAGTTT
CATTTCTTTTAAAATAAGCATGTGAAGGCAATGTGTGTTC
CTTATTAAAAACCTCTTTGATTTGGCCTGCTTTCTTTGTC
TGTTTTGTTCCTTCTGTTTGTTTAAAGAATCCTTACTAAC
ACTAAAATGCCAGACTTTTATCTTTTGCACTCATGACGCT
TCTGTAAGTTTAATCCTCCTTTGTTTTTCCGTTTTCTTTT
CTGATTTATTATTTCCAGCTCATCTTAACCGACCACATGT
TAAACAAATGTTTCTGTTATTTCAGATTACGTTCGGGTCA
GAGATTCCCAAGTCCTACTATGTCCGAGACTCCATTAAAG
TGGACTATGAACAGTCTGTGAGTATCGGCCGGGGCTCGTC
TCATCAGATGGAATATGAGCTTATCGCACCAAACTGTGCA
CTAAGGTGGCAGTTCTCCTGTGATGGGGCAGATATAGGGT
TTGGGGTGTATCTGAAGAAGAAGATGGGAGAGAGGATGAA
GGCTGGTGAAATGAGGGAAATTGTGCCGAATCAGCGTTAC
AACGCACACCTGGTTCCTGAAGATGGCTCACTCACCTGCC
CAGAACCAGGAGTCTATGTCCTGCGATTTGACAACACATA
CAGCGTCTTCCAGTCCAAAACGGTCAAATTTACAGTGGAG
GTCCTCCTACCCAGTCAAGTCAACCAATCAGACAACTAGA
AATGACGGAAACCAGAAAGAAGCTGCCAATAACTTGAGAT
TATAAAGAAACGTCAGCTCTTAGGCATAACAAACTGATCA
CAAATCTGTTGTTCATATTAAA

sec14l8 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA sec14l8-002 822
mRNA sec14l8-201 (1) 2353
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
sec14l8-002 Contained in:

OTHER sec14l8-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000032521 (1)
  • Ensembl_Trans:ENSDART00000144810 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BI890129 (1) 786 bp
    GenBank:DT076079 (1) 768 bp
    GenBank:BG305595 (1) 470 bp
    CITATIONS (2)