Transcript

xrcc3-201

ID
ZDB-TSCRIPT-090929-481
Name
xrcc3-201
Previous Names
  • xrcc3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000005307 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000005307|OTTDARG00000004930|ZDB-GENE-050320-116 xrcc3|OTTDARP00000004778 xrcc3-001 LG_ BX255905.4 Danio rerio protein_coding KNOWN, 1672 bp
AGCGCGATAATATGAAGGGTCAGTGCTTTAGCCGTTACGC
TAACGCTATTCTCTTTTTGTTTTGTTAAAATTAAGTATTG
TTCTTTATATGTATTGCTTCTTACTGCATGTCTTTGAAGA
AACGTAAATAAATATCGTTAGCCGGCTGGATTTAAGACTT
TAATTTTGACAGACTATATGACACAATGACCGGGAAGTAA
ACATCGTGCAGTTCAAAATGTGCGCAAATAGTTTTAGTTA
ACGTTAGTTGAAATGTTTATTCATTGTTTTATTAACGTTA
AACTGTTATTATGGAGATTCAAGTTTGGTGATGGAGTGGG
AACAACTTGAGCTGAATCCAAGGATTATTGCTGCTGTTAA
AAAAGGCAATTTTAGATCAGCCAAAGAGATCCTGTGTGTA
TCTGGTCCAGATCTGCAGAGACTGACGCGCTTGTCAAAGG
CTGATGTCCAGCGTCTTCATCAGGCGGTAGCGGCTTCTGT
GCGCAAGTCTAAACCCGTCACAGCATTGCAGTTGATCCAG
GGAGAATGTCCTGTTTTGGAGCCTGGACACCGGCTCTCTT
TTGCCTGCCCTGTTCTGGACGGTCTGATGCGTGGTGGTCT
CCCATTACGAGGAATAACAGAACTGGCAGGCGAGAGCGCT
GCTGGAAAAACCCAGTTTTGTTTGCAGCTTTGCTTGTCTG
TCCAGTATCCACAAGAACACGGAGGACTGAATTCAGGGGC
TGTTTACATTTGCACTGAGGATTCTTTCCCTATCAAACGA
CTACGGCAACTCATTACCCAGCAGCCCCGGCTCAGACCTG
ACCTGCCGCCAGCCCTGATCCACAGTCTGCGTTTTAGTGA
CAACATCTACATCGAGCATGCAGCAGACCTGGAGGCTCTG
CAGGTGTGTGTGTCTCAGCGTGTGCCGGTGCTGCTGAAGC
GAGGTCTGGTCAGACTGCTAGTGGTAGACTCTGTGGCAGC
TCTGTTTCGCAGTGAGTTTCAGGCTGATGAGGCCGTTCAG
AGGTCTCGACATCTGCTGGCTTTTTCCAGTACGCTCCACC
GCCTCAGTCACACATACGCTGCACCTGTACTGTGTGTCAA
CCAGGTTACAGATGTTGTTGACGGCCCAAATCCAGGAAGA
TGCGATTATGGACTGGTGGGCAGTAAAGTGCTTCCAGCAT
TGGGCATCGCCTGGGCCAATCAGGTGATGGTGAGGCTAAT
GCTCAGGAGGCTGGCAGGACAGGTCAAATCAGACAGCCGA
AGCTGTGCTCCTCGAAAATTAGAAGTGGTTTTTGCCCCAC
ACCTGCCTCGATCAAGCTGCCTGTGTGGGGTTTGGGAGGA
AGGGGTGAGAGGAATCCTTGATGGAGACTCAGATCTGCAG
ACACAGTGATTCAGCAGATGGAGAACTCTCTCTCAGTACT
ACAGGACAGTTAATGGAGGTAATAGCTCAACATTTGTAAG
GACTTTGTGAGGAATGGTTGCATTTTTACCATTTGAAACG
AATATGCATTATTTCCAAGTACGTTTGTAAAATCAATTCA
ATTTTTTATAATACTTTAATTTCTTTTCTTTTTTTTAAAT
ATTGATATTATGTCCTTTAATAAATGTTTTTTTATGTTTT
CAAATGTTTTTTATTCTATCTGTAATAAGCGAAGTGAATA
AAGGGTGATGCTTTCTCACTGCTGCCCTTGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations