Transcript

xrcc3-202

ID
ZDB-TSCRIPT-090929-12858
Name
xrcc3-202
Previous Names
  • xrcc3-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000030717 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000030717|OTTDARG00000004930|ZDB-GENE-050320-116 xrcc3|OTTDARP00000025009 xrcc3-002 LG_ BX255905.4 Danio rerio protein_coding KNOWN, 777 bp
GGCAAACCCCAGCTCTAAAGCGCGATAATATGAAGGCATT
GCAGTTGATCCAGGGAGAATGTCCTGTTTTGGAGCCTGGA
CACCGGCTCTCTTTTGCCTGCCCTGTTCTGGACGGTCTGA
TGCGTGGTGGTCTCCCATTACGAGGAATAACAGAACTGGC
AGGCGAGAGCGCTGCTGGAAAAACCCAGTTTTGTTTGCAG
CTTTGCTTGTCTGTCCAGTATCCACAAGAACACGGAGGAC
TGAATTCAGGGGCTGTTTACATTTGCACTGAGGATTCTTT
CCCTATCAAACGACTACGGCAACTCATTACCCAGCAGCCC
CGGCTCAGACCTGACCTGCCGCCAGCCCTGATCCACAGTC
TGCGTTTTAGTGACAACATCTACATCGAGCATGCAGCAGA
CCTGGAGGCTCTGCAGGTGTGTGTGTCTCAGCGTGTGCCG
GTGCTGCTGAAGCGAGGTCTGGTCAGACTGCTAGTGGTAG
ACTCTGTGGCAGCTCTGTTTCGCAGTGAGTTTCAGGCTGA
TGAGGCCGTTCAGAGGTCTCGACATCTGCTGGCTTTTTCC
AGTACGCTCCACCGCCTCAGTCACACATACGCTGCACCTG
TACTGTGTGTCAACCAGGTTACAGATGTTGTTGACGGCCC
AAATCCAGGAAGATGCGATTATGGACTGGTGGGCAGTAAA
GTGCTTCCAGCATTGGGCATCGCCTGGGCCAATCAGGTGA
TGGTGAGGCTAATGCTCAGGAGGCTGGCAGGACAGGTCAA
ATCAGACAGCCGAAGCT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations