ZFIN ID: ZDB-TSCRIPT-090929-4590
Transcript Name: hdr-201
Previous Name: hdr-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000019824 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000019824|OTTDARG00000016487|ZDB-GENE-030826-5 hdr|OTTDARP00000016754 hdr-002 LG_ BX323062.10 Danio rerio protein_coding KNOWN, 1647 bp
CATCAGTAGGATGGCATTGGGACGCAATCTACATTCGGTC
ATACGGAGAAAGTGAGATAATGATTGGACTACTATGAGAT
ACATTACTTTATTGGTTTTGCTGTTACTAAATGTCATAAA
TGCTGCTAGAAGTCATGGGGATCTGGCCTGGGCTCACAGA
TCTGTCAAGAACAGATTAAGCCGAGATGTTTCATGCAGGG
AAGGCTTGGAATATCCACATGAAAACATCTGCTGTCTAAA
CTGCCCTGCTGGAACCTATGTGAAAAAAGCTTGTGCTGCT
GCTGCAGAAAAAGGAGTGTGTGCACCTTGTGAGTTTGACA
CATATACTGAACATGACCATGGATTGTTAAAGTGCATATC
TTGCGACAAGTGCCGTATAGACCAGGAAACCATAGAGAAA
TGCACAAGCACCCAGAACACAAGGTGCAAGTGCAGAAATG
GGTCATTTTGTTTGCCTGACCAGGCTTGTGAGGTGTGCAA
GAAATGCAGCAGATGCAAAGAGGATGAAGAAACTGAAAAA
AGCTGCACAGCCATTTCAAACACAGTCTGTAGAAAGAGAA
GCTCTCCGGGAAGCTCCACCTCAATGACTTTCATTGTTAT
CATGCCATTAATTGTATTGCTGGCATGCGTTTTGTGCATC
GTCTACTGGACAAAGTCAAAACAAAATAAAACAGCAGTAA
CATCACGAAGTCCAAGGGAGATGGTTAAGATCTGTATGGG
TGACAGTGAGGAGGTCAGAGAGGAGAAGCAGAATGATCAC
AACTCCAGGATTGATGACTCCTCTCAGCTCCAGCCGTTCC
TCGAGCAAAACTATGTGGTGGGTACCAGTGTTCCCCATCC
ATCAGAGGCAGAAAAAGACAAGGGGCTAGGTGACAGTCTT
CCTAACACCGCCAACTCTTCACAAACTAGTCTGGCCATTT
GTGCTGTGCCCAGTGATCTGCAGTCCTGCCACACTAACCA
GTCAAGCAGCTCTGTACTTGCCTGGCAGCCTCCTGCTTTG
GAAAGCGAGTCATCAAGAAGACTTGTTCCTTTGAGCGGTG
AAGAATCCTTGAAGAAAACTTTTGATTTCTTTGAAGAAAT
TGATGTCCATTATCATAACCGATTCTTCAGGCTGATTGGA
CTGAGTGATAATGCCATCAAAAGCGCTGAGTCACTTTTTC
CAGAAGACAGAGTTTACGAACTATTAAAAATCTGGATGGA
AAAGGAAGGACTGAAGGCAGATTTCAACAGTCTTATTGAC
GCATTAATTTATTTAGACCAGAGGCTGTCAGCAGAAAATA
TCATTGCAAAGGCAATAAATAATAGTTGCTTTAAATATGA
AGAAGAGTGACTGAATGCTACTATTGTCACCCTCTTAGCA
TTCTCAGTGGACGAAGGTACAGTATGCTTTTCAGTTTCAT
TTTGTCCATTGCTAAAGTGTTTCTCTGACAAGGTATTTAT
TATGTTAGCAAATGTTTAAACTTTTAGATTAGTTGGTCAC
GAACATTAGTTACATTTAAAATGACAAAACAAAGTATTTA
AGACATCTGAGGTTATGAAATTTGTAGTCAGAAACTTGGC
AATGTTTTTTTTCTTTTTCTTTTCATGTTGTATATATTTG
ATGTGTGCCATGTGATAATTTTGTTAACTAATAAAGGAAT
TCATTTA

hdr TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA hdr-201 1647
hdr-202 (1)    Ensembl 1441
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hdr-201 Contained in:
[BAC] DKEYP-38H2 (1)

Genome Resources: Vega_Trans:OTTDART00000019824 (1),  Ensembl_Trans:ENSDART00000005025 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC085545 (1) 1689 nt
GenBank:BC164857 (1) 1324 nt
CITATIONS (2)