ZFIN ID: ZDB-TSCRIPT-090929-4589
Transcript Name: hdr-202
Previous Name: hdr-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000019823 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000019823|OTTDARG00000016487|ZDB-GENE-030826-5 hdr|OTTDARP00000016753 hdr-001 LG_ BX323062.10 Danio rerio protein_coding KNOWN, 1441 bp
CATCAGTAGGATGGCATTGGGACGCAATCTACATTCGGTC
ATACGGAGAAAGTGAGATAATGATTGGACTACTATGAGAT
ACATTACTTTATTGGTTTTGCTGTTACTAAATGTCATAAA
TGCTGCTAGAAGTCATGGGGATCTGGCCTGGGCTCACAGA
TCTGTCAAGAACAGATTAAGCCGAGATGTTTCATGCAGGG
AAGGCTTGGAATATCCACATGAAAACATCTGCTGTCTAAA
CTGCCCTGCTGGAACCTATGTGAAAAAAGCTTGTGCTGCT
GCTGCAGAAAAAGGAGTGTGTGCACCTTGTGAGTTTGACA
CATATACTGAACATGACCATGGATTGTTAAAGTGCATATC
TTGCGACAAGTGCCGTATAGACCAGGAAACCATAGAGAAA
TGCACAAGCACCCAGAACACAAGGTGCAAGTGCAGAAATG
GGTCATTTTGTTTGCCTGACCAGGCTTGTGAGGTGTGCAA
GAAATGCAGCAGATGCAAAGAGGATGAAGAAACTGAAAAA
AGCTGCACAGCCATTTCAAACACAGTCTGTAGAAAGAGAA
GCTCTCCGGGAAGCTCCACCTCAATGACTTTCATTGTTAT
CATGCCATTAATTGTATTGCTGGCATGCGTTTTGTGCATC
GTCTACTGGACAAAGTCAAAACAAAATAAAACAGCAGTAA
CATCACGAAGTCCAAGGGAGATGGTTAAGATCTGTATGGG
TGACAGTGAGGAGGTCAGAGAGGAGAAGCAGAATGATCAC
AACTCCAGGATTGATGACTCCTCTCAGCTCCAGCCGTTCC
TCGAGCAAAACTATGTGGAAAGCGAGTCATCAAGAAGACT
TGTTCCTTTGAGCGGTGAAGAATCCTTGAAGAAAACTTTT
GATTTCTTTGAAGAAATTGATGTCCATTATCATAACCGAT
TCTTCAGGCTGATTGGACTGAGTGATAATGCCATCAAAAG
CGCTGAGTCACTTTTTCCAGAAGACAGAGTTTACGAACTA
TTAAAAATCTGGATGGAAAAGGAAGGACTGAAGGCAGATT
TCAACAGTCTTATTGACGCATTAATTTATTTAGACCAGAG
GCTGTCAGCAGAAAATATCATTGCAAAGGCAATAAATAAT
AGTTGCTTTAAATATGAAGAAGAGTGACTGAATGCTACTA
TTGTCACCCTCTTAGCATTCTCAGTGGACGAAGGTACAGT
ATGCTTTTCAGTTTCATTTTGTCCATTGCTAAAGTGTTTC
TCTGACAAGGTATTTATTATGTTAGCAAATGTTTAAACTT
TTAGATTAGTTGGTCACGAACATTAGTTACATTTAAAATG
ACAAAACAAAGTATTTAAGACATCTGAGGTTATGAAATTT
GTAGTCAGAAACTTGGCAATGTTTTTTTTCTTTTTCTTTT
CATGTTGTATATATTTGATGTGTGCCATGTGATAATTTTG
T

hdr TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA hdr-201 (1)    Ensembl 1647
hdr-202 1441
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hdr-202 Contained in:
[BAC] DKEYP-38H2 (1)

Genome Resources: Vega_Trans:OTTDART00000019823 (1),  Ensembl_Trans:ENSDART00000121886 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:AF302789 (1) 1451 nt
GenBank:CN014707 (1) 895 nt
GenBank:BI891398 (1) 721 nt
GenBank:CK239082 (1) 717 nt
GenBank:CK675596 (1) 454 nt
GenBank:CK678789 (1) 449 nt
GenBank:CK703988 (1) 362 nt
CITATIONS (2)