ZFIN ID: ZDB-TSCRIPT-090929-4017
Transcript Name: hoxa1a-202
Previous Name: hoxa1a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000018141 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000018141|OTTDARG00000015149|ZDB-GENE-000823-5 hoxa1a|OTTDARP00000015305 hoxa1a-001 LG_ CR382300.12 Danio rerio protein_coding KNOWN, 1441 bp
TCAACCCAGGGTGAATGGTGCGACGTTAATCAGTTCCGGG
CCCAAAGTTCTGTCAGTGTGGCAACCACGAGCTGAGACGC
CCAAGAAGATGACACAATGAGCACATTCTTAGATTTTTCG
TCCATAAGTGGTGGTGGAGATGGAGGTAGCGGGGGCTCGT
GCTCAGTCAGGGCGTTCCACGGTGATCACGGACTTTCAAC
ATTCCAATCGTCGTGTGCTGTTAGGTTAAATAGCTGCAGT
GGAGATGAACGGTTCATGTCCAATATATCGTCACAAGATG
TAATTAACTCTCAGCCACAACAGGCCGGCTCGTACCAGTC
CCCCGGGACTTTGTCAATTACCTACAGCGCCCATCCAAGT
TATGGAACTCAAAGTTTTTGCACTGGATACAATCACTATG
CCCTAAATCAGGACGTGGAATCGTCTGTGAGCTTTCCCCA
GTGTGGCCCGTTAGTTTACTCTGGAAATATTTCTTCCACT
GTTGTGCAGCACCGTCATCATCGTCATGGTTACAGTAGCG
GAAACGTTCACCTCCATGGCCAGTTCCAGTACGGCTCAGC
CACATATGGTAATAGTTCGGATCAGGCAAACCTTACGTTT
GTGGCGGGCTGCTCAAATCCGCTTTCCCCTCTGCATGTGC
CTCATCATGATGCTTGTTGTTCACCTCTATCAGATGGCGT
GCCCACGGGACAGACATTTGACTGGATGAAGGTTAAACGC
AACCCGCCAAAAACAGGAAAAGCTGGGGAGTATGGATTTG
GTGGGCAGCCAAACACTGTACGCACCAATTTTTCGACAAA
ACAGCTGACAGAGCTTGAAAAGGAGTTTCATTTCAATAAG
TACTTGACTCGCGCAAGGCGCGTGGAGATCGCGGCTTCTC
TCCAATTGAATGAGACTCAGGTGAAGATATGGTTTCAAAA
TCGCCGTATGAAACAAAAGAAGCGCGAAAAGGAAGGTCTT
TTGCCGAAATCTTTGTCCGAACAGAAAGATGGTCTCGAAA
AAACAGAGGATGCATCTGAAAAGTCGCCCTCTGCACCATC
CACGCCCTCTCCTTCACCAACTGTTGAGGCATACTCCTCT
AATTAAACAGCTTTCACATTTGTTCTTTCAAATTGTAAAC
AATAATGCAAAATTGTTTGTGACTTGTCTTATGGTTATTT
GTACATCATGTTTTAACATAAGTGGAAGAGTGTTTTAGCG
ACCAACCGTTTCTAACTCGACCATTTTGATCACTCATTGT
TTATCTGTGCACTATTTATGTTAATGTGAAATAACTGTTA
ATTGTCTTGGGCACTTTGTCAAGCACCTGGATAGAAAGAA
GTGGCTTGTGCATTTTTGTGCACAGTAATAACAAATGCTG
CACTTTTACGCGCGTCTTAGTTTGAACTTGTAAACCACTT
GTCAAAATGTCTACCTCAAGAACCGAAGGAAATAGTGCAA
T

hoxa1a TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA hoxa1a-201 (1) 885
hoxa1a-202 1441
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hoxa1a-202 Contained in:
OTHER hoxa1a-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000018141 (1)
  • Ensembl_Trans:ENSDART00000167757 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC162701 (1) 1108bp
    GenBank:AJ306430 (1) 990bp
    GenBank:EE708906 (1) 907bp
    CITATIONS (2)