ZFIN ID: ZDB-TSCRIPT-090929-4018
Transcript Name: hoxa1a-201
Previous Name: hoxa1a-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000018142 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000018142|OTTDARG00000015149|ZDB-GENE-000823-5 hoxa1a|OTTDARP00000015306 hoxa1a-002 LG_ CR382300.12 Danio rerio protein_coding KNOWN, 885 bp
ATGAGCACATTCTTAGATTTTTCGTCCATAAGTGGTGGTG
GAGATGGAGGTAGCGGGGGCTCGTGCTCAGTCAGGGCGTT
CCACGGTGATCACGGACTTTCAACATTCCAATCGTCGTGT
GCTGTTAGGTTAAATAGCTGCAGTGGAGATGAACGGTTCA
TGTCCAATATATCGTCACAAGATGTAATTAACTCTCAGCC
ACAACAGGCCGGCTCGTACCAGTCCCCCGGGACTTTGTCA
ATTACCTACAGCGCCCATCCAAGTTATGGAACTCAAAGTT
TTTGCACTGGATACAATCACTATGCCCTAAATCAGGACGT
GGAATCGTCTGTGAGCTTTCCCCAGTGTGGCCCGTTAGTT
TACTCTGGAAATATTTCTTCCACTGTTGTGCAGCACCGTC
ATCATCGTCATGGTTACAGTAGCGGAAACGTTCACCTCCA
TGGCCAGTTCCAGTACGGCTCAGCCACATATGATGGCGTG
CCCACGGGACAGACATTTGACTGGATGAAGGTTAAACGCA
ACCCGCCAAAAACAGGAAAAGCTGGGGAGTATGGATTTGG
TGGGCAGCCAAACACTGTACGCACCAATTTTTCGACAAAA
CAGCTGACAGAGCTTGAAAAGGAGTTTCATTTCAATAAGT
ACTTGACTCGCGCAAGGCGCGTGGAGATCGCGGCTTCTCT
CCAATTGAATGAGACTCAGGTGAAGATATGGTTTCAAAAT
CGCCGTATGAAACAAAAGAAGCGCGAAAAGGAAGGTCTTT
TGCCGAAATCTTTGTCCGAACAGAAAGATGGTCTCGAAAA
AACAGAGGATGCATCTGAAAAGTCGCCCTCTGCACCATCC
ACGCCCTCTCCTTCACCAACTGTTGAGGCATACTCCTCTA
ATTAA

hoxa1a TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA hoxa1a-201 885
hoxa1a-202 (1) 1441
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hoxa1a-201 Contained in:
OTHER hoxa1a-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000018142 (1)
  • Ensembl_Trans:ENSDART00000163546 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AJ306431 (1) 885bp
    CITATIONS (2)