Transcript

clasrp-003

ID
ZDB-TSCRIPT-090929-3959
Name
clasrp-003
Previous Names
  • si:dkey-7l12.4-003
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000017946 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000017946|OTTDARG00000014990|ZDB-GENE-060503-837 clasrp|no_translation DKEY-7L12.4-003 LG_ BX927074.16 Danio rerio protein_coding NOVEL, 1083 bp
TAAGATCCAGCAACAGGAGCACAAGCGACAGGAAAGAGAG
GGAGTTCTTCGCGCAATGGCACGGAAAATACGCATGAAGT
GAGTCTGAGCATGTACATACATGTGCAACCCATTCATGTA
GGAACTGTCCTCTGGGTTTGTGAAGGAGAGGATACAGTTT
GGTCATTGTTTGGTCTTGCAGGGAACGGGAACGGCGGGAA
AAAGAGAGAGATGAATGGGAGAGACAGTATGGACGTCAGA
GTCATTCGCCCTCCCCCAATGCCAAATACAGTCGGGACTA
CGGCTCATCGAGAAGGAGATCACGCTCAAGATCACGGAGT
CCTCCTTACCGGTACTGAAGAACCTGCTGATAAAAGAGAC
AATGACACATCAAACAGATGGTTTAGGAGTGATTACAACA
GTTTACATGCAAGTCTGGAGGGAAATTACAAATAAAATGA
ATATCACTCACTGCAGCTTCTCTTACGTCTTCTAAGGATG
CAATGGAAACCAACTAAATCCTTTCTTAAATTGTGAAAAT
TAACAACATCATGCTATAGAAACGCATATGAACTCTTTAT
TACACAGAAAACATGAATTGTTGGGAATGTTTTGAGCTGC
TAGGATTCTTACAAAGCTTTGCAGATTGTTTTTGGTCGAA
CTTTGATAATTATGCCGAAGATTGGGATGGATCCTCTTCC
CTCTTGTCTTAAAGCCCCATTAAAGAGTGTTCACACACAC
AAAAAAATACAAATTGTTGCGATTTTCTCACCCTCATGTC
TTTCCAAACACCTTTGGCTGACTGACTTTCTTGAAAAACA
TCATTCTGACAAACTTTGCTTTCGGTAGAAGTAGGAAAAA
AGGTCAGCAAGGCTGAGTAAGTGACATACTTGTGTTTTCT
AGGTAAACCTTTCCATTTGACCTCATTGTACATAATATCT
TCATTAAAGAGAGTACATTTCTTTTAAAGAAAATGCTAAT
TCTATTTGCTCATCTTTTTCACTCAGCAATGTAAATGTCT
GGTGGTTCTTTCTTCTATTGAAAACAATCATCAGTGACCA
CACATTTTGACAGAAATAAAAACCTAAACATGAATGAAAA
ATG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations