ZFIN ID: ZDB-TSCRIPT-090929-3957
Transcript Name: clasrp-201
Previous Names: clasrp-001, si:dkey-7l12.4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000017944 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000017944|OTTDARG00000014990|ZDB-GENE-060503-837 clasrp|OTTDARP00000015158 DKEY-7L12.4-001 LG_ BX927074.16 Danio rerio protein_coding NOVEL, 2758 bp
TCCATTAAGAAACCCCGACTTCCTAAAGTGTAAACATAAA
CAGCAGCCCTGCCCCGACGCGCCCCAACCCCAAGCGGAGC
CGTCATGTGGCAGGAGGCCCGCAAACATGAACGCAAACTG
CGAGGGATGATGGTGGACTACAAACGGCGTGGGGAAAGGC
GAAGAGAGTACTATGAAAAAATTAAAAAGGATCCAGCCCA
GTTCCTGCAAGTTCATGGCAGAGCCTACAAAATCCACCTG
GATTCAGCTGTCGCCCTGGCAGCTGAGAGTCCCATAAACA
TGATGCCTTGGCAAGGAGATACCAACAACATGATTGACAG
GTTTGATGTCAGAGCTCACCTGGACTACATCCCTACTTAT
ACGCCTCTACCCATCCTTAGCACTACCACCCCTGAGCAGG
AATCAGAAGAGCGGAAGTGCAATTATGAGCGCTACAGAGG
GCTGGTGCAGAACGACTTTGCCTGCATCTCTGAAGAACAG
TGCTTGTACCAGATCTATGTGGATGAACTCTACGGTGGCC
TACAGAAGCCAAATGAGGATGAAAAGAAAAAACTCGCTGA
GAAGAAAGCTCAGATTGGTTATACGTATGAGGACAGCACA
GTGACTGAACAAGATGAACAATCAAAGAAGGGAACTGAGG
AGGATTCGGAAAACAGCGAGTCTGAGGAAGACGAAATCAT
CCCTGACATCGATGTTGAGGTGGACGTAGATGAACTGAGC
CCTGAACAGGTGTTGGAGATTAACAAGATGGCCACCACTT
ACGGCATGGCAGACGGAGACTTTGTTTGGATGTTGAGGAA
AGACAAGGAGGAAGTGGAGGCCATTAAACACGCTAAAGCA
CTGGAGGCAGAGAAGGCCATGTACTCTGGCCGGCGGTCTC
GCAGACAACGAAGAGAGTTCAGAGAGAAGTATATGAAAGG
CAGGCAGATCAGCCCACCCAGCTATGCCAGAAGAGACAGT
CCTACATATGACCCCTACAAACGGCCAGAGTCGGACTCAA
GTTCAGAGTCACGCTCTCGTTCCCGAACTCCAGGCAATGA
TAAGATCACCTTCATCACAAGCTTTGGGGGCAGTGATGAA
GAGGGAGCCACTGCCACAGCAGCCCCACCTGCAGCGGCAT
CAAGCCACAGCACCTCCAACAGCGCAGGTCATAGCAGGGG
CTCCCGCCGAAGACGGTCTTCTTCCAGTCCTTCATCATTT
TCCTCTCGCTCCTCATCACACCGTTCGTCACGCTCATCCT
CACGTTCTCGTCGGAGTCGTCGTTCCCGTGGCGGCAGGGA
CCGGGACAGCCGCTACTCCAGGTCTCGATCTCGCTCTCGG
CGACGATCTGACTCACGGTCACGGCAGCGCAGTGGAGGAG
TAAGTTCAAGAAGACGATACGACAGGACGAGGTCTCGTTC
TGTGGATCGGGGGAGAGACAGAAACAGAGATCGGGACAGG
GGGAGGCGCTACACGGGTCGTAGACGAACCAGATCTCGCT
CACGTTCACGATCAGTTGATCGTTATCGGCAGCGAAGTCG
CAGTTCTGCATACAGGAGGGGCGGCAGTATCAGTCAAAGC
CCCTCACGTTCCCCTGCTGCAAGCCGCAGCTCCTCCCCCT
CCTCCTATTCTGCTCTACCTGGCTCTGCTGCTCCAGACAA
ACTGAGAAAGCCTGAAACTCCGGGTGGTAAAGAGACTGGA
GCTGCCAAACCCAAGATGACACCTCAAGAAAAACTCAAAC
TCCGCATGCAGAAGGCCCTGAACAGGCAATCCAAGGCGGA
TAAGAAGGCGGCACAAGCTAAGATCCAGCAACAGGAGCAC
AAGCGACAGGAAAGAGAGGGAGTTCTTCGCGCAATGGCAC
GGAAAATACGCATGAAGGAACGGGAACGGCGGGAAAAAGA
GAGAGATGAATGGGAGAGACAGTATGGACGTCAGAGTCAT
TCGCCCTCCCCCAATGCCAAATACAGTCGGGACTACGGCT
CATCGAGAAGGAGATCACGCTCAAGATCACGGAGTCCTCC
TTACCGGTACTGAAGAACCTGCTGATAAAAGAGACAATGA
CACATCAAACAGATGGTTTAGGAGTGATTACAACAGTTTA
CATGCAAGTCTGGAGGGAAATTACAAATAAAATGAATATC
ACTCACTGCAGCTTCTCTTACGTCTTCTAAGGATGCAATG
GAAACCAACTAAATCCTTTCTTAAATTGTGAAAATTAACA
ACATCATGCTATAGAAACGCATATGAACTCTTTATTACAC
AGAAAACATGAATTGTTGGGAATGTTTTGAGCTGCTAGGA
TTCTTACAAAGCTTTGCAGATTGTTTTTGGTCGAACTTTG
ATAATTATGCCGAAGATTGGGATGGATCCTCTTCCCTCTT
GTCTTAAAGCCCCATTAAAGAGTGTTCACACACACAAAAA
AATACAAATTGTTGCGATTTTCTCACCCTCATGTCTTTCC
AAACACCTTTGGCTGACTGACTTTCTTGAAAAACATCATT
CTGACAAACTTTGCTTTCGGTAGAAGTAGGAAAAAAGGTC
AGCAAGGCTGAGTAAGTGACATACTTGTGTTTTCTAGGTA
AACCTTTCCATTTGACCTCATTGTACATAATATCTTCATT
AAAGAGAGTACATTTCTTTTAAAGAAAATGCTAATTCTAT
TTGCTCATCTTTTTCACTCAGCAATGTAAATGTCTGGTGG
TTCTTTCTTCTATTGAAAACAATCATCAGTGACCACACAT
TTTGACAGAAATAAAAACCTAAACATGAATGAAAAATG

clasrp TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA clasrp-201 2758
clasrp-203 (1)    Ensembl 1113
ncRNA clasrp-003 (1)    Ensembl 1083
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
clasrp-201 Contained in:
[BAC] DKEY-7L12 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000017944 (1),  Ensembl_Trans:ENSDART00000127825 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CN505952 (1) 852 nt
GenBank:BG884085 (1) 540 nt
GenBank:BI705553 (1) 508 nt
GenBank:BG884030 (1) 467 nt
GenBank:AL927219 (1) 459 nt
GenBank:BF156482 (1) 337 nt
CITATIONS (2)