ZFIN ID: ZDB-TSCRIPT-090929-3958
Transcript Name: clasrp-203
Previous Names: clasrp-002, si:dkey-7l12.4-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000017945 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000017945|OTTDARG00000014990|ZDB-GENE-060503-837 clasrp|OTTDARP00000015159 DKEY-7L12.4-002 LG_ BX927074.16 Danio rerio protein_coding NOVEL, 1113 bp
GCCTGAAACTCCGGGTGGTAAAGAGACTGGAGCTGCCAAA
GTCACCCAAGATGACACCTCAAGAAAAACTCAAACTCCGC
ATGCAGAAGGCCCTGAACAGGCAATCCAAGGCGGATAAGA
AGGCGGCACAAGCTAAGATCCAGCAACAGGAGCACAAGCG
ACAGGAAAGAGAGGGAGTTCTTCGCGCAATGGCACGGAAA
ATACGCATGAAGGAACGGGAACGGCGGGAAAAAGAGAGAG
ATGAATGGGAGAGACAGTATGGACGTCAGAGTCATTCGCC
CTCCCCCAATGCCAAATACAGTCGGGACTACGGCTCATCG
AGAAGGAGATCACGCTCAAGATCACGGAGTCCTCCTTACC
GGTACTGAAGAACCTGCTGATAAAAGAGACAATGACACAT
CAAACAGATGGTTTAGGAGTGATTACAACAGTTTACATGC
AAGTCTGGAGGGAAATTACAAATAAAATGAATATCACTCA
CTGCAGCTTCTCTTACGTCTTCTAAGGATGCAATGGAAAC
CAACTAAATCCTTTCTTAAATTGTGAAAATTAACAACATC
ATGCTATAGAAACGCATATGAACTCTTTATTACACAGAAA
ACATGAATTGTTGGGAATGTTTTGAGCTGCTAGGATTCTT
ACAAAGCTTTGCAGATTGTTTTTGGTCGAACTTTGATAAT
TATGCCGAAGATTGGGATGGATCCTCTTCCCTCTTGTCTT
AAAGCCCCATTAAAGAGTGTTCACACACACAAAAAAATAC
AAATTGTTGCGATTTTCTCACCCTCATGTCTTTCCAAACA
CCTTTGGCTGACTGACTTTCTTGAAAAACATCATTCTGAC
AAACTTTGCTTTCGGTAGAAGTAGGAAAAAAGGTCAGCAA
GGCTGAGTAAGTGACATACTTGTGTTTTCTAGGTAAACCT
TTCCATTTGACCTCATTGTACATAATATCTTCATTAAAGA
GAGTACATTTCTTTTAAAGAAAATGCTAATTCTATTTGCT
CATCTTTTTCACTCAGCAATGTAAATGTCTGGTGGTTCTT
TCTTCTATTGAAAACAATCATCAGTGACCACACATTTTGA
CAGAAATAAAAACCTAAACATGAATGAAAAATG

clasrp TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA clasrp-201 (1)    Ensembl 2758
clasrp-203 1113
ncRNA clasrp-003 (1)    Ensembl 1083
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
clasrp-203 Contained in:
[BAC] DKEY-7L12 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000017945 (1),  Ensembl_Trans:ENSDART00000148032 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BI709120 (1) 491 nt
GenBank:BG892318 (1) 458 nt
CITATIONS (2)