header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-3662
Transcript Name: hars-202
Previous Name: hars-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000017138 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000017138|OTTDARG00000014352|ZDB-GENE-040912-152 hars|OTTDARP00000014514 CH211-235C4.2-002 LG_ BX890575.23 Danio rerio protein_coding KNOWN, 1817 bp
CCTTTGAGCAGGCGCACTAGCGACGTCAAACGCCTGCGAC
GGCGCCCGCAGTATCTGCAGTTCGGTCGCAGGTTCTTCAT
CGGCTGTGTTTCTGGAGCACCATGGCCGATAAAGCACAGC
TGCAAGAGGCGATTAAAACACAAGGAGAGGTGGTCAGAAA
ACTCAAAAGTGAGAAAGCGAGCAAAGAACAGATTGATGAA
GAAGTGGCCAGACTGTTGCAGCTCAAAGCTCAGCTGGGAG
GAGACGAAGGAAAACATGTATTTGTTCTCAAAACAGCCAA
GGGGACCAGAGACTACAACCCCAAACAGATGGCTATACGA
GAGAAGGTTTTCAACATCATCATCAACTGCTTTAAACGCC
ATGGTGCCGAAACCATCGATTCCCCCGTCTTTGAGCTGAA
GGAAACGTTGACGGGGAAGTATGGAGAAGACTCCAAACTC
ATCTATGATCTGAAGGACCAGGGGGGAGAACTTCTGTCTC
TGAGATACGACCTCACTGTACCATTTGCTCGCTATCTCGC
AATGAACAAAATCACCAACATCAAGCGCTACCACATTGCT
AAAGTGTACCGCAGAGACAACCCAGCCATGACCCGGGGCC
GATACAGGGAGTTTTACCAGTGTGATTTCGATATTGCAGG
TCAATACGATGCAATGATCCCTGATGCAGAGTGTCTGAAG
CTTGTCTACGAGATCCTGAGTGAATTAGATCTTGGAGATT
TTCGTATCAAGGTGAACGACAGACGCATTCTAGATGGGAT
GTTCGCTATTTGTGGTGTTCCTGATGAGAAGTTCCGCACA
ATCTGCTCCACAGTGGATAAACTGGACAAGTTGGCCTGGG
AGGAAGTGAAAAAGGAGATGGTGAATGAGAAGGGGCTTTC
AGAAGAAGTAGCCGATCGAATCAGGGATTATGTCAGCATG
CAGGGTGGGAAGGATCTGGCTGAGCGGCTGCTTCAGGATC
CCAAACTGTCCCAAAGCAAACAGGCCTGTGCTGGCATCAC
AGATATGAAGCTGCTTTTCAGTTACCTGGAGCTCTTTCAG
ATCACAGACAAGGTGGTGTTTGATCTGAGTCTGGCGCGAG
GACTGGACTACTACACTGGTGTGATTTATGAAGCCATTCT
CACTCAGGCCAACCCGGCACCGGCATCTACACCTGCGGAG
CAGAACGGGGCAGAGGATGCGGGTGTAAGTGTTGGTAGTG
TGGCTGGAGGAGGACGATACGACGGCCTGGTGGGGATGTT
TGACCCCAAAGGCAGGAAAGTGCCCTGTGTGGGGGTCAGC
ATTGGCATTGAGAGGGTCTTCTCCATCATGGAGCAGAAGG
CAGAGCTGTCTTCAGAGAAGGTGCGCACCACTGAAACTCA
AGTGCTTGTGGCTTCAGCACAGAAGAACCTTCTAGAGGAG
AGACTAAAACTCACAGCTGAGCTCTGGAATGCTGGAATCA
AGGCTGAAGTTTTATACAAGAAAAACCCAAAGCTGCTGAG
TCAACTGCAGCACTGTGAGGACACCGGCATTCCTCTCGTG
GCCATCTTAGGAGAGCAAGAGCTCAAAGACGGCGTCGTCA
AACTGAGGAATGTGGCCAGTCGAGAAGAGGTGGACGTGCC
CAGAGCAGAGCTGGTGGATGAAGTCAAGAAGCGGACATCG
TAGTCTTACAAACAGTCAGCATATAGACAGCGGAGAACTG
TGGAGCTATTTAACACACGTCAGTTACAGTTGCGTCAGTC
AAACATGTACACTAAACGAGGAAACATTCATTGCATTGCC
TGCAGTTTTAAAATGTGATTGGGTTATGTCAATCTATCAA
TAAATGAGTAAACCAGG

hars TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA hars-201 (1) 2081
hars-202 1817
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hars-202 Contained in:
OTHER hars-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000017138 (1)
  • Ensembl_Trans:ENSDART00000142158 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CN501193 (1) 929bp
    GenBank:DV588224 (1) 849bp
    GenBank:DT880746 (1) 771bp
    CITATIONS (2)