header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-3661
Transcript Name: hars-201
Previous Name: hars-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000017137 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000017137|OTTDARG00000014352|ZDB-GENE-040912-152 hars|OTTDARP00000014513 CH211-235C4.2-001 LG_ BX890575.23 Danio rerio protein_coding KNOWN, 2081 bp
CCGCAGTATCTGCAGTTCGGTCGCAGGTTCTTCATCGGCT
GTGTTTCTGGAGCACCATGGCCGATAAAGCACAGCTGCAA
GAGGCGATTAAAACACAAGGAGAGGTGGTCAGAAAACTCA
AAAGTGAGAAAGCGAGCAAAGAACAGTGACTGGGTTGCTC
ACCACTTTTCTCCTGTTCTTCCTGCTTGTTCCACGGATTC
CACCGCCACCGCCATCATCACCGTCATCACTGCTCTCCTG
GATTATCTGGGCTGTTTGTGGGATTGGATGCTTCACCTGT
GAACTCTGTTGGACTGTCTGGTATTGTGACATTGGTGTGT
GTGTGTGTGTTTGGACTGTTGATAATGGCCGCTCTGGGAC
TGGTCTCCATGCGCTTGTGTGCTGGACTCATGGGTCGTCG
GTCTGCTGTGCGTCTGCATTCCCTGCGTGTCTGTTCTGGG
ATGACCATATCACAGATTGATGAAGAAGTGGCCAGACTGT
TGCAGCTCAAAGCTCAGCTGGGAGGAGACGAAGGAAAACA
TGTATTTGTTCTCAAAACAGCCAAGGGGACCAGAGACTAC
AACCCCAAACAGATGGCTATACGAGAGAAGGTTTTCAACA
TCATCATCAACTGCTTTAAACGCCATGGTGCCGAAACCAT
CGATTCCCCCGTCTTTGAGCTGAAGGAAACGTTGACGGGG
AAGTATGGAGAAGACTCCAAACTCATCTATGATCTGAAGG
ACCAGGGGGGAGAACTTCTGTCTCTGAGATACGACCTCAC
TGTACCATTTGCTCGCTATCTCGCAATGAACAAAATCACC
AACATCAAGCGCTACCACATTGCTAAAGTGTACCGCAGAG
ACAACCCAGCCATGACCCGGGGCCGATACAGGGAGTTTTA
CCAGTGTGATTTCGATATTGCAGGTCAATACGATGCAATG
ATCCCTGATGCAGAGTGTCTGAAGCTTGTCTACGAGATCC
TGAGTGAATTAGATCTTGGAGATTTTCGTATCAAGGTGAA
CGACAGACGCATTCTAGATGGGATGTTCGCTATTTGTGGT
GTTCCTGATGAGAAGTTCCGCACAATCTGCTCCACAGTGG
ATAAACTGGACAAGTTGGCCTGGGAGGAAGTGAAAAAGGA
GATGGTGAATGAGAAGGGGCTTTCAGAAGAAGTAGCCGAT
CGAATCAGGGATTATGTCAGCATGCAGGGTGGGAAGGATC
TGGCTGAGCGGCTGCTTCAGGATCCCAAACTGTCCCAAAG
CAAACAGGCCTGTGCTGGCATCACAGATATGAAGCTGCTT
TTCAGTTACCTGGAGCTCTTTCAGATCACAGACAAGGTGG
TGTTTGATCTGAGTCTGGCGCGAGGACTGGACTACTACAC
TGGTGTGATTTATGAAGCCATTCTCACTCAGGCCAACCCG
GCACCGGCATCTACACCTGCGGAGCAGAACGGGGCAGAGG
ATGCGGGTGTAAGTGTTGGTAGTGTGGCTGGAGGAGGACG
ATACGACGGCCTGGTGGGGATGTTTGACCCCAAAGGCAGG
AAAGTGCCCTGTGTGGGGGTCAGCATTGGCATTGAGAGGG
TCTTCTCCATCATGGAGCAGAAGGCAGAGCTGTCTTCAGA
GAAGGTGCGCACCACTGAAACTCAAGTGCTTGTGGCTTCA
GCACAGAAGAACCTTCTAGAGGAGAGACTAAAACTCACAG
CTGAGCTCTGGAATGCTGGAATCAAGGCTGAAGTTTTATA
CAAGAAAAACCCAAAGCTGCTGAGTCAACTGCAGCACTGT
GAGGACACCGGCATTCCTCTCGTGGCCATCTTAGGAGAGC
AAGAGCTCAAAGACGGCGTCGTCAAACTGAGGAATGTGGC
CAGTCGAGAAGAGGTGGACGTGCCCAGAGCAGAGCTGGTG
GATGAAGTCAAGAAGCGGACATCGTAGTCTTACAAACAGT
CAGCATATAGACAGCGGAGAACTGTGGAGCTATTTAACAC
ACGTCAGTTACAGTTGCGTCAGTCAAACATGTACACTAAA
CGAGGAAACATTCATTGCATTGCCTGCAGTTTTAAAATGT
GATTGGGTTATGTCAATCTATCAATAAATGAGTAAACCAG
G

hars TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA hars-201 2081
hars-202 (1) 1817
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hars-201 Contained in:
OTHER hars-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000017137 (1)
  • Ensembl_Trans:ENSDART00000141471 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC081624 (1) 2083bp
    GenBank:CN018497 (1) 925bp
    GenBank:CN839091 (1) 890bp
    GenBank:CK704305 (1) 842bp
    GenBank:CK030381 (1) 804bp
    GenBank:CN511656 (1) 765bp
    GenBank:DT059337 (1) 748bp
    GenBank:AI957786 (1) 644bp
    GenBank:AW279991 (1) 600bp
    GenBank:AI958913 (1) 554bp
    GenBank:AL923542 (1) 536bp
    GenBank:AW280944 (1) 505bp
    CITATIONS (2)