header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-3565
Transcript Name: krt17-201
Previous Names: krt17-001, si:dkeyp-113d7.7-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000016877 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000016877|OTTDARG00000014145|ZDB-GENE-060503-86 krt17|OTTDARP00000014306 DKEYP-113D7.7-001 LG_ BX323079.7 Danio rerio protein_coding NOVEL, 1500 bp
TTTTCTACACTCATCCGCTCACTCCTTCTCCAGGCAGAGC
AGACAACGACAGCACGACTTCTTCAAAATGATGTCATCTT
CATCCATCCGTATGTCCTCAGGAGGATCGTCTCGCTTCAC
AGGAGTGCGTGCTGGTAGTGTCTATGGAGGAGCAGGAGGA
TCCGGTGTTCGCATCTCCAGTTCTTCTGCTTCCCGATCCT
ACTCTGCTGGCGGTGGGGCAGGATTTGGTGGTGGTGCTGG
TGCTGGCTTCAACCTGTCTGATGGCATTGATTCGTCTGCA
AATGAGAAAGCCACCATGCAAAACCTCAATGATCGTCTGG
CCTCCTACCTGGAGAAGGTGCGCATCCTGGAGAAGGAAAA
CGCAGATCTTGAGCTGAAGATCCGCCAGTTCCTGGACAGC
AAGGCCACGCCTAATGCTCGTGACTACAGTGCCTACTATG
CGACAATCAGTGACCTCCAGGCCAAGATCCTGCATGCTAC
TGGTGTAAATGCAGGCATCTACCTCCACATTGACAATGCC
AAGCTGGCTGCAGATGACTTCAAGGTCAAGTTTGACAATG
AGCAGAGCATGAGGCATGCTGTAGAAGCAGACATCTCTGG
CTTGAGGAAGGTGCTGGATGAGCTCACAATGACCAGATCT
GACCTCGAGATGCAGATTGAGGGTCTGAAAGAAGAACTTG
TCTTCCTCAAGAAGAACCACGAGGAGGAACTCTTGGCAGC
ACGCACCCAGATGGGCGGACAAGTCAACGTAGAGGTTGAC
GCAGCACCACAGGAAGACCTGACAAAGATCATAGCTGATA
TCCGTGAGCACTATGAGGCAGTTTCTGCCAAGTACCAAAA
AGATTTTGAGCAATGGTTCCAGTCCAAGAGTGAGTCCCTC
AACAAGGAAGTTGCTGCCAGCACAGAAACTCTCCAATCAT
CCCGCTCTGAATTCACAGAGCTGAAGCGCACACTCCAGAG
TCTTCAAATCGAACTACAGTCACAACTCAGCATGAAAGCG
TCATTGGAAGGCACTCTGGCAGACACACAGGCCCGCTACG
CCAACATGTTGAATGGTTACCAGTTACAGGTGGGCAGCCT
GGAAGAGCAGCTGGTGCATCTTCGTGGTGATCTGGAGCGT
CAAAGACAAGAGTACCAGATGCTTCTGGACATCAAGACCA
GACTGGAGATGGAGATTGCAGAGTACAGAAGACTGCTGGA
TGGAGAGGCTACTAGTGTATCCACAAGCTCAAGCAAAACC
TCCACCACACGCAAAGTAGTAACCATTGTGGAAGAGGTGG
TGGATGGAAAAGTGGTCAGCTCATCCTCCAAGGCCACAAG
CCAGACTAAAACCACTTAAAAGAAATCTTCAGCAAAAGAG
TTCTCAATCAGTGTGATAATAAAGTCAATAAACTGGTCTC
ACTGTATTTTTGTGCTTGTCTTGTTTTGGAATTCATGCAT
CATTTATATCATGTATAATAGCAAAAAGTCATCCATTAAT
ATCAAAATAAATGTTGTCAA

krt17 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA krt17-201 1500
krt17-202 (1) 869
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
krt17-201 Contained in:
[BAC] DKEYP-113D7 (1)
OTHER krt17-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000016877 (1)
  • Ensembl_Trans:ENSDART00000105004 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC153512 (1) 1414bp
    GenBank:CN022941 (1) 892bp
    GenBank:CT655253 (1) 858bp
    GenBank:CT699761 (1) 799bp
    CITATIONS (2)