ZFIN ID: ZDB-TSCRIPT-120213-860
Transcript Name: krt17-202
Previous Names: krt17-002, dkeyp-113d7.7-002, si:dkeyp-113d7.7-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000053198 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000053198|OTTDARG00000014145|ZDB-GENE-060503-86 krt17|OTTDARP00000041849 DKEYP-113D7.7-002 LG_ BX323079.7 Danio rerio protein_coding NOVEL, 869 bp
CAAAGCTGACTTAGAAGATATGCAATTACTTTGCTCTGCA
GTATTAAGCAACTCATTATTTTTTTAAATTAGGATCTACA
ATTTACTTTTTTTTATTAGATTCATAAAATTTTTTTTACA
TATTCAAATCTACTTTTTGCTTTTAATTAAAAATGAAAGA
ATTCCTACTTCAGAAGCTAATGGCTACCAATTTCTAACAT
CCTTGGGCAGAGCAGACAACGACAGCACGACTTCTTCAAA
ATGATGTCATCTTCATCCATCCGTATGTCCTCAGGAGGAT
CGTCTCGCTTCACAGGAGTGCGTGCTGGTAGTGTCTATGG
AGGAGCAGGAGGATCCGGTGTTCGCATCTCCAGTTCTTCT
GCTTCCCGATCCTACTCTGCTGGCGGTGGGGCAGGATTTG
GTGGTGGTGCTGGTGCTGGCTTCAACCTGTCTGATGGCAT
TGATTCGTCTGCAAATGAGAAAGCCACCATGCAAAACCTC
AATGATCGTCTGGCCTCCTACCTGGAGAAGGTGCGCATCC
TGGAGAAGGAAAACGCAGATCTTGAGCTGAAGATCCGCCA
GTTCCTGGACAGCAAGGCCACGCCTAATGCTCGTGACTAC
AGTGCCTACTATGCGACAATCAGTGACCTCCAGGCCAAGA
TCCTGCATGCTACTGGTGTAAATGCAGGCATCTACCTCCA
CATTGACAATGCCAAGCTGGCTGCAGATGACTTCAAGGTC
AAGTTTGACAATGAGCAGAGCATGAGGCATGCTGTAGAAG
CAGACATCTCTGGCTTGAGGAAGGTGCTGGATGAGCTCAC
AATGACCAGATCTGACCTCGAGATGCAGATTGAGGGTCTG
AAAGAAGAACTTGTCTTCCTCAAGAAGAA

krt17 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA krt17-201 (1) 1500
krt17-202 869
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
krt17-202 Contained in:
[BAC] DKEYP-113D7 (1)
OTHER krt17-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000053198 (1)
  • Ensembl_Trans:ENSDART00000151326 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EE710678 (1) 863bp
    GenBank:CK673986 (1) 169bp
    CITATIONS (2)