ZFIN ID: ZDB-TSCRIPT-090929-2873
Transcript Name: plcg2-202
Previous Name: plcg2-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000014673 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000014673|OTTDARG00000012465|ZDB-GENE-030131-9532 plcg2|OTTDARP00000012501 CH211-260P9.2-002 LG_ BX511124.5 Danio rerio protein_coding NOVEL, 500 bp
ATAAACAAAACAGGTTCGCTGTATGACTCTAAGCAGTATG
TTGAGGCTAACGAGATCGAGCCGTCTCTGCCCCAGAACAC
AGTGAAGGCTCTTTATGACTACAGGGCAATGCGTCCTGAT
GAGCTCACCTTTTCAAAAGGTGTTTTGATCCATAATGTGA
CCAGGGACACAAATGGATGGTGGAAAGGAGACTATGGTGG
AAAACTCCAGCACTATTTCCCTTCAAATTACGTAGAAGAA
GTCCAATCTGATGCCAATTACCAGCCCGAAGAGGAAAATC
CATTAGGTGAATTGTGTAAAGGCACAGTGGACATCTCAAA
GTGCACTGTTGGTAAGAGTACATCATTTTTATATGTTTTT
TAAATGAACTTTAAGACTTAGACTTAATTAACAATTAATT
AAAGGGGTAGTTCGTCCCAAAAAGTAACTTCTGTCATCAT
TTACTCTATTGTTCCACACCTTTTTGAATTTCTTCTGTTG
AACACAAATTAATATACAGT

plcg2 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA plcg2-201 (1)    Ensembl 4296
plcg2-202 500
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
plcg2-202 Contained in:
[BAC] CH211-260P9 (1)

Genome Resources: Vega_Trans:OTTDART00000014673 (1),  Ensembl_Trans:ENSDART00000148127 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CD588033 (1) 500 nt
CITATIONS (2)