ZFIN ID: ZDB-TSCRIPT-090929-2872
Transcript Name: plcg2-201
Previous Name: plcg2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000014672 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000014672|OTTDARG00000012465|ZDB-GENE-030131-9532 plcg2|OTTDARP00000012500 CH211-260P9.2-001 LG_ BX511124.5 Danio rerio protein_coding NOVEL, 4296 bp
TCCTCAACCTGAACACCCATCGTTTATAATCGCTTCGTCT
ACATCCATAAGTAGCTTTTTTGGCATATATCTTCTCAGGC
ACGAGGGCACGCTAGTTTAGCAGGACTTTGCACACATCGC
CCTCTCTTCCCAGGGGATTTTGCATAGATAATTTTGCTTC
CGGATTTTTTTTTAATTCTCATAATGTTCTCTTCACTTCC
TTGTGCTTAGCGAATAGAGGAACTGACCACATTGAAACTA
GACTGATCATAGAGAGATTTTTCCTCAATACTGTATTATT
GATTTATTTCTATCATGAGAATTCGTTTGATTGCAGCAGG
TGGTTATCGAAGCGGTCATTGAAATTCCTCTCCAAACTTG
GTGTGTGGCCGGACGCAGAGATGGCGGGTCGTGCTCATCA
GGGAGACCTGACCGAGTACAAGAAGAGCCTCATCAAGCGG
GACTTGGAGATGGGGATAGTGATGACGGTGTACAGGCAGA
GGATTGAGAGACTCACGGTGCAGGTCATTATGGAGACGCG
GCAGGTGGCCTGGTCACGCACCGCCAACAAGACTGAAGGA
GTGTTGGACATTTTTGAAATCCGGGAAGTACGACCAGGAA
AAAACTCCAAAGAATTTGATCGCTTCAAGGACCACAAAGA
TAGAAATACAGACCCAAACACATGCTTTACCATATTCTAC
GGCTCTCAGTTTGTTCTCAACACTCTCAGTCTGGGAGCTG
ATTCGGTGGAAGATGCAGAAAAATGGCTGACAGGATTGGA
GTTACTCAGAGATGAGACACTGGCAGCTCACACACCAGAG
ATTATAGAGAGTTGGCTGAGGAAACAGATGTATTCAGTTG
ATCAGACGAAGAAAAACAGCATCACCATGAAAGAGCTGAA
GTCCCTTTTGCCACAGATGAACTTTAAAGTACCTTGTGGA
CGCTTTTTGAAGGACAAATTTGCGGCATTGGGAGCAAAGA
AGGAGGTCCTGGATTTTGAGCAATTTCACAAATTTTACAA
TTCTTTGATATTTGAGAACCAAAAGTCGATTTTAGATGAG
TTTAAAAAGGAGACGTGTGCTTTCATCCTGGGTAATGGTG
ATCAGCCTATTCAACTCAGTGATTTCCAAAGGTTCCTTTT
ATATCAGCAAAGAGAGACTTGGGCTAACAATCTGAATCAA
GTCCGAGAGTTAATGACCATCTTCATCGACGACACCATGA
GGGAAACCAATGATCCTGCATTTATCCTTGAAGAGTTCCT
CAGTTTTCTCTTCTCCAAAGAAAACCAAATTTGGGATGAC
AAGTTTTCCGAGATTTGCCCACTGGACATGAACAATCCTC
TGTCTCACTACTGGATCAACTCGTCTCACAACACATATTT
AACTGGAGATCAGCTGCGTAGTGAGTCTTCAACAGAAGCG
TATGTGCGCTGTCTGAGGCTGGGCTGTCGCTGTGTTGAAT
TGGACTGCTGGAATGGTCCAGAGGAACCTATTATATATCA
CGGCTGGACCAGAACCTCCAAGATAAAGTTTAAAGATGTG
GTGAAGGCCATCAATGATCACGCTTTCGCAACATCTGAGT
ATCCTGTGGTGCTGTCCATAGAAGAACACTGTGACGTCAA
GCAACAGAAAATGATGGCTCAGGTGTTCAAAGATGTTTTC
CAGGACAAAATCCTGATGGAACCTCTGGAACCAGAAGCAG
AACAACTGCCATCACCAACCCAGCTCAAGGGCAAGATCAT
CATTAAGCACAAAAAACTGAACATCGATCAGACCTTTGGC
AGAAAGGACCTTCGAAAAGGAGATAAGCAAGGAGAGCTCT
TCATCTGGGATCCAATAGATGAGAGGTGGTACAGGCACTA
CTGTGTGATTGAGAATAAAACGCTCTATTATGCGGAGGAG
AATGATGAAGAGGAAGAAAAGTCGGTCCAGTCTTGCACGG
AGCTTCATCAGTCTGAGCCGTGGTTTCATGGCCGGATGTC
CGAGGGCCGAATGACTGCAGAAAGACTGCTGCAGGAATAC
TGTGCTGAATCGGGTGGAGTTGATGGAACATTTCTGGTTC
GGGAGAGTGACACCTTCGTAAATGATTGCACACTTTCATT
CTGGCGCAGTGGACGAGTTCAGCATTGTCGAATCCGTTCC
TGCTTGGAAGGAGGACACACAGTTTATTTCCTGACAGAAA
ACCTGCACTTCCCCAGCGTGTATGCTCTCATCTATTATTA
CAGAGACAACCTGCTCCGCTGTCAGGATTTCAACCTGCGC
CTCACTGAATATGTGCCTAAACCAGACACGCACCAGTTGG
AAGGGTGGTTTTACAGTAACTTGAGTCGGGGTGAGGCGGA
GGACTATCTAATGCGGATCCCTCGAGACGGAGCCTTCCTC
ATCAGACAGAGAGAGGATTCAGACTCGTATGCCATCACAT
TCAGAGGCGAAGGCTTGGTGAAGCACTGCCGGATACACAA
AGACGGCTCTATGTACATTCTGGGCACTTCTAGTGAGTTT
GACAGCCTGGTGGAACTAGTGGACTATTTCCGAAAGAAGC
CGCTGTATCGAAAAACAAAACTGCGCTATCCTGTTACACC
AGAACTAGTAGAGCGCTTCAGTTCGATAAACAAAACAGGT
TCGCTGTATGACTCTAAGCAGTATGTTGAGGCTAACGAGA
TCGAGCCGTCTCTGCCCCAGAACACAGTGAAGGCTCTTTA
TGACTACAGGGCAATGCGTCCTGATGAGCTCACCTTTTCA
AAAGGTGTTTTGATCCATAATGTGACCAGGGACACAAATG
GATGGTGGAAAGGAGACTATGGTGGAAAACTCCAGCACTA
TTTCCCTTCAAATTACGTAGAAGAAGTCCAATCTGATGCC
AATTACCAGCCCGAAGAGGAAAATCCATTAGGTGAATTGT
GTAAAGGCACAGTGGACATCTCAAAGTGCACTGTTGTTCG
CTCTGCCAAACATGGCAAACAAGTGGTGGTAACTCTGCAG
TATAAGGAGGATAAAGAGAACATGATGCCATTTGATTTGG
CCACCGAGACCACTGAAGAGCTGTACGAGTGGTATCAGGT
GGCCTGGGACATTACGCAGAGAGAGGAAAACCTAGTGTTT
GAGAAAGAAAAAACGAAGGAAGTGGAGACCAGAGATGAAG
TGGCCAGTGAGATGTCAGAACTGGTTGTTTACTGCCAGCC
ACGCAGCAAAGAAAAGGACGGCTTTGATAATTATACCTAC
AAAGAAGTCCGCTCCTTCGTAGAGAATAAGACGCCCTCCA
GAAACAAGCTGACTCAGTTCATGTTGTATAACCGCAAGGC
TTTGAGCCGCATCTATCCTAAAGGCCAGCGGGTGGATTCC
TCCAACTATGACCCGTATCCGCTGTGGATGTGTGGCTGTC
ACATGGTAGCGCTCAACTTCCAGACGGCTGATAAGTACAC
TCAGCTGAACAGCGCCCTCTTCAGTCTAAATGGAAGCACA
GGATATGTACTGCAACCTGAGCTGATGCGCAGAGATTCAT
ATGACCCTCAACAGGAGAGGAAGAACATCAAATATACTAT
CGGAATCAGAGTGATTGGAGCACGGCATCTTCCCAAACCA
GGACGAAGTATTGCCAGCCCCTTTGTGGAGATTGAGCTGT
GTGGTCAAACAGATGAGAGCAAATTCAAGACTACCGTTTG
CCATGACAATGGGCTGAACCCTATATGGCAGCCTTCAGAG
ATGTTTGTTTTCAGCGTGTATGAGCCGGACCTCACCTTTC
TACGCTTTGTGGTCTTTGAAGAGGACATGTTCTCTGACCC
AAATTTCCTTGCCCAGGCTACATTCCCAGTGAAAGGTGTC
CGCTCAGGCTACAGATCGGTTCCTTTAAAGAATGGCTTCA
GTGAAAATCTGGAGCTGGCATCTCTACTGGTCTGTGTTGA
TGTACAGCAGGTGGAGAAAGCACAGGAGGAACTTTACTCC
TCCTCGAAACAGTTGCAAAAGAAGCAGGCGGAGATGAGCA
GCGAGTTCTGCCTTTACGACACTCACTCCAACCTGCGCTC
CAGTGGCCCTCAACGCCGCGAAGACCTCTCGCAGTTCACT
TACTCTGAAAAAAAGATAAATAAACCACAGCAAAAGATAA
ACAACAGCAAGTTCTACTCGTGAGGGAAACGGGCGCCTCT
AAGTCTAGTTCCCTCTCAAACTGCATTGAACATTTTTAAG
GGTCTCTTCCTCTTGATTCTGCTGCTCTAGTACTACTGGT
TCCCCAACAGGCCACAAAGACAGGAAGTTGCAGTTTTTCA
CTTCTGTGGTCACAAAGGACCAAATTGGAGAGAGCGTTTG
AGAAATGCTCATCAGA

plcg2 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA plcg2-201 4296
plcg2-202 (1)    Ensembl 500
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
plcg2-201 Contained in:
[BAC] CH211-260P9 (1)

Genome Resources: Vega_Trans:OTTDART00000014672 (1),  Ensembl_Trans:ENSDART00000080709 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BG303816 (1) 733 nt
GenBank:BM775680 (1) 657 nt
GenBank:BF157932 (1) 623 nt
GenBank:BM775345 (1) 565 nt
GenBank:AW420677 (1) 405 nt
CITATIONS (2)