Transcript

ptprq-002

ID
ZDB-TSCRIPT-090929-2758
Name
ptprq-002
Previous Names
  • si:ch211-11f8.3-002
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000014214 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000014214|OTTDARG00000012173|ZDB-GENE-050419-183 ptprq|no_translation CH211-11F8.3-002 LG_ AL928990.4 Danio rerio protein_coding NOVEL, 523 bp
TCATTTCAAAACAAGATTATTTTGCTCACCACATTGACAG
ATTAGTTTGCTTCTTATCTGTTGTTTGTCTAAAATGACTC
TTGGTTTATTTTTTTGATATTTGGACTAGAAACAAGAAAA
AAAGTTGTAGGTGAGAAACATTTTTGCAGTGTATAGTTGT
ATGTTTAAAGGCCATAAAGAAAGCTGTACTGCAGACTTAA
TGTGAATAATGCTGAAGTTGATGGTTTTTCATGTTTTGTG
AGTATTTTCACACTCTTTCTAACACATTTGCAGGCCAATC
AGTAAGAAATCGTTTCTTCAGCATGTGGAAGATCTTTGTG
CCAACGACAACGCCAAGTTTCAGGAGGAGTTTGCTGAGTT
GCCGAAGCTGCTGCAGGATCTGGCCACATCAGACGCTGAC
CTGCCTTGGAATCGCTCCAAAAATCGCTTCACAAACATCA
AGCCCTACAACAATAGCCGAGTGAAGTTGCTGTCTGAGCC
AGGAATGCCGGGTTCTGACTACATCAATGCCAGCTTCGTC
TCT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations