Community Action Needed: Please respond to the NIH RFI
Transcript

ptprq-202

ID
ZDB-TSCRIPT-090929-2757
Name
ptprq-202
Previous Names
  • ptprq-001
  • si:ch211-11f8.3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000014213 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000014213|OTTDARG00000012173|ZDB-GENE-050419-183 ptprq|OTTDARP00000012149 CH211-11F8.3-001 LG_ AL928990.4 Danio rerio protein_coding NOVEL, 6906 bp
GTGTCCAGCGTCACCCCAGGAACGTCTTACACCGTGACGG
TCAATGCAGTGGCTTCATCAGGCTTCAGTTCTCCTGTCAG
CCGAATACTGGTCACCACTATTGAGTCCTCGGCCCCCTCT
AAACCTGAAGGTGAACGGGTCGGTTCCACCGGCATCCTGC
TGTCCTGGCGGATGCCGATGCCTCTCGACCCCTCCATTCA
CTCATTCGTCATCAGATATAAGGAGATGTGTCCATATCCA
GACCCCAGCTTCACGGAGATCACCAAGAGCCTGGACATCC
CAGAAACCCTGCTGAACACACTCACCCCTGGAGCCACATA
CAACATCAAGGTTGCGGCAGTGAATAAAGCAGGAGTTGGA
CCATTTAGCCAGTCTCTGTACTACAAAACAGCAGAGGCCC
CTCCTGGTCTGGTGTCGAATCTCACAGCGTTTGCTGAGGA
TCACACATCAGTCATTGTGACCTGGTTTCTCCCTGTACGT
ATTAATGGCCTCATCACTAAGTTTGCAGTGAAAGTCAAGC
ATGCTCGAACAGGCCAGATCGTCCGCACGAAGGAACTGAA
CGCTGAGGATATCATGAACGGAGCCTTGCCTCACTGCAAC
GATGCTGCAGATATTTTATCCCGTGGGACTCCGAGCCCAT
CCCAGACTTCCCAGTTGACATCTGCTGTGTTGCCCCCGAT
TACACTGTCAGCAGTTCCACCCGCCTCCATCTGGAGTGTA
CCAATCAGTGTGAAGATTGATGAGCTCCGCCCCTACACTC
CTTATGTGTTTGAGGTCTCCGCCTTCACCAGTGACGGGGA
GGGCCAGATCGCCAGCACTATGGTCCGCATGCCAGAGGCT
GCCCCTGAAGACCCACCGCAAAATGTAGTTTTAAGAAACA
TTACTTCTAAATCCGTGTCTCTAACTTGGGAGCCTCCAAA
GATCATCACAGGACGCTTCAGTTATGTTATCCAGCTTCAC
AGCTCTGAAGGGTTGATTAGTGAGAACAGCACAATCGATC
AGATGTTTATTTACACTGGACTGACTCCATACACAACATA
CTACATCCATGTGATGGCCAAATCAGCAGGTGCCGCAGGA
CCAGCAGCAGTGATCAACATTACAACACTAGCAGAAGCCC
CGAGCGCAGTGTCTCTTCTGAAAGCAGAGGCTGTGGACTC
CACATCAGTCCGTCTGTCCTGGCGATCCCCAATCCAACCC
AATGGTCTGATCACTCACTACCGCATTCTGGTGCTGTACC
ATGATACACTTGTACAGGACATCACCCTGAGAGGACAGAA
TCTCATTTCTCCACTTCGTCGCAATGCAAGGTCACTTGAC
TTCACCACAGAATCTGTGTTTACTCTTACCTCACATGAAA
CATTTTCCACTCTGGGTCGTGATTTTACCAACACTGATAC
AGAAGCACCATCAGCCCTTCCTCTGACCCCGAGTACCCCC
CACACTCCTCCACCATGGCTCACGGTGACCCACGACAGAA
CCGACGCATCCGTTCAGACTCAGACTGATGCTGTAACTGA
AGACCTGACGACTGAACACCCACCTGTCACTCCAGTCCTA
CCAGCCACTGAGGTGTCAGCAGACCTGTCATCTGATCAAA
TCACGCATGTGGTTCGAAGACTGAGTCCGTTCACCGAATA
CAAATTTAGCGTGTCAGCCAAAAACATCATTGGGGAAGGA
CCTTCCACCGAAGTTACAGTGAAAACAAATGAACAGGTGC
CCAGCTCTGTTCAGAATGTGTCCTATCAGAACCTGTCGTC
TACATCCATCCGTGTTTCATGGGAGCCGCCGCTAAACCCT
AACGGCAAGATAACACACTATGCTGTGTATGCGCAAAATC
TGCTTACTAACCAAGAGTTACGACAGATGACGGACACCAC
CACTGCTGTCCTCACAGGTCTGGACAAGTACAGCAGCTAT
AAGGTGCGAGTGGCGGCGTCCACTGCTGTGGGAGAAAGTC
CTCTAACCAATGAAGACTACATCTACGTTGTGACACTAGA
GGATGTGCCGGATTCGCCCCCACGGGGTCTGACCATAGTG
AAAACCACCTCCTCCACCGCTACACTCTCCTGGTCTCCAC
CCGAGAAGCCCAACGGCATCATCCGCATGTATGAGATCTC
CTACACCAACGGCACATACAGTAACACAGTCAACAGCACA
TCGGCCAGTGCAACGCTCCGATACCTGAAGCCACACACAC
ACTACAATGTGACTGTCCGTGCATTTACACTACTCGGACA
TGGAGAGCAGATTTCTGAAACACTACAGATGCTGTCAGGA
GAGGATGTGCCTGGCAGTCCCCCTTATGATCTGTCCTATG
AGAGCATCGGCTCCAGCTCAGTGAACGTATCCTGGTCTCC
TCCACTCCTCGCAAACGGTGTCATCCTCTTCTATAATGTG
GAATACTGGAACGCCACACAAAGCCTGAACCAAACCACAC
ACATGCCATACATCGTCCTGTCTAACCTGCGAAAATATGC
ACACTACCGCATCAGCGTCCAGGCAGCCACACAGGTGGGC
ATGGGCAACCACACCAGCGAGATCCTCAACATCACCACAC
TGGAGGACGTACCCAGTTCTCCTCCAAAATTCCTAATTGC
CAGGAAATTGTCAGATACTGAGGTAGAGTTGTCCTGGGAG
GCCCCGGAGGAGGCCAACTCTGAGATTTTATACTACATAG
TAAGAGTGTGGAATCTGAGCACTGAGTTTGTGGCCAATGT
GACGGAAACATCAGTAGTTGTGAGTGTGGATGGACCGGGT
CAGTATAACGCCTCTGTGAGCAGCTGGACTCGACTCGGGG
ATGGAGGATTGCTGATTTACATCACATTCAGTACTATAGA
ATCAGCCCCCTCTGACCCTCCACAGGATGTAGTATACACA
CTCCTTACCATCAGTACAGTGCGTCTCAGCTGGAGACCCC
CAAATGAACCCAACGGCATCATTCAGTACTACACCATCTA
CTACACAGACAATAATACAGAGTACACAGAGAGGGTTCCT
GGTTCAGAGCACCAGCTGCTGTTGTCTGATCTGCAGGCGG
GACAGGACTACAGTGTATGGATGAGTTCCAGCACCTCTGT
TGGTGATGGGGGATTGTTCAGTCCCTCTCTAAACTTCACC
ACCTTAGAGGACGTGCCGAGTGGTCCCGTCCACAACCTCA
GCGCCACCATCTACAGCTCCACAGCGGTGGTGATCAGCTG
GGATCCTCCTCTGGAGCCCAATGGTAGAGTTTACTACCAG
CTGAGCCTGCAGGAGGCGGGCATCACCCACCCGTCCATCA
ACCGCACAGTCAACATGACCATCACCAAAACCACCACCGA
CACCATCTACCTCTTCACCAAGCTCAGGAAGTATTTCCCC
TACATCATAAACGTCACACCAGCCACGAGTGCAGGATCCG
CTGTAAACCACACTACAATGCTACACCTGCGGACAGATGA
AGATGTTCCGAGTTCTCCTCCATTGTCTGGATCAAACAAG
AATCTCTCCAGCACCTCCATCCAGGTGTCGTGGTTTCCCC
CAGTGGAGGCTAATGGCGAGATTATAGAGTATGCTGTGAA
TTTACAGGGTCCTTCCACCTCCAACAAAAACTACACCTCT
GAGACACATCTGGTGCTGTCAGAACTCACTCCGTTTACAC
CATACAATCTCTCCATCGCTGCGGTCACTCGTGTCGGTAC
CGGCCCCCCGGTGGTTCTTTCACTACATACTGATGAAGCA
GGCCCGATGTCTCCGCCACGCAATCTGACTATATTTAACC
ACACTGCAAATTCAGTGTGGCTTCAGTGGGAACCAAGTCC
AGAGCCGAATGGAGTTGTACAGCTTTACGGATTCAGAATA
CTGGAATTGAATACAGACTCTTTCAGATACCAGAACTCAT
CTGATGCGTCCACACAAGCAGAACTGGGTGGCTTCAAACC
TCATAATTCATATGAAATCAGTGTGTGCACATTCACTAGA
GCAGGAAATGGAGATCAGTACAGCCTGCCTGTCTTATTCA
CCACCAATGAATCAGTGTCAGATGCTGTTGGGAATCTGAG
CTGCTCTGGATTGGATTGGGATTCAGTCTACATGGAATGG
GAGCTTCCGGATCACCCTAATGGAGAGATCCTGTATTACC
TCATTCGCTCTGGAGATCTGGAGGATGAGGCTCACCCTGT
GGTCCTCACACACACTGTGGCTCACACGCTCACTGGCCTT
TCACCTCACGCTTTCTACCTCATCACTGTGGCTGCAGTAA
ATTCAGCCGGTGTGGGAGAAGAAGCAAACTGCAGCGCACA
CACTCCACCAGAGTCAGTTCCCGGTCCCTCCCATTCGCTG
ACCGTTACGGACGTCACCTCTGACAGTGTGTCTGTAAGCT
GGCAGCGTCCCGTTCATGTGCCAGGTCTTTTGCAGGGTTA
CAATGTAGAGATCGAGCAATTATCCAGAAACTGTGAGCGG
CAGCAGCAGCAAGTGGAGTCTTGTATGGAGGCTCAGATCT
TGGAATGGGTTGAAGGAGAAACCACCAGAGCCACACTGAC
CTCTCTGCTCAAATACAGACAGTATCGTATCAGGGTCGTG
GCCTTCACCAGAGCTGGAGCCGGAGAGCCTTCAGAGTGGA
TCTACACACAGACGCTCGCAGGAAACCCTGACGCTCCTCC
TGGCGCTATCTCTGTGGTTCCTTCTGCCAATGGGTTGAAG
ATTGAGTGGGACAAACCATCAGTCATCTCGGGGCCCACAT
CATACATCATCGACATCACTGCTCTGGACGGTTCGGGATA
TAACATAACTTTAGTGCGGCATTCAGAAGAGATCAGGACA
GTGATTGTCGGGAACCTGAGTGCATTTACTCTGCACTCTG
TTACCATCACCGCCTTCACCGGGCCACTCTCCAACGCTCG
CAGAGACGGCAAAGCATCTGAACCTGTCCTCATCAGAACC
TTGGAGGATGAGCCCAAAGATCCTCCAAAAAACGTGACAT
TGACAGTGATTCCGGAGGAAGTGACGCGTGTTTATGTAAC
ATTCTCCCCACCGGATGAGCCAAATGGAAACATCAGCGCA
TATCGTGTCGACATCTACCGCAACGGGCAGCTGGACTTCT
TCATCAACAGCCTGTCTGTGATCAGCAACCCAAATAATAC
CATGACAGCCATAATTGATGGATTAAAAGGTGGATTTAAT
TACAGCATAAGGATAGCAGCTGTGAATGGAGCAGGTTTTG
GACCAAGTTCGGAGGTTCATGTCACCACAGGTGTGAAAGC
TCCTCCCAAACCGAAGAAGACGCCGCGGGCAGCTCTGAAC
AGTGCTGGTGTCATCATCTCAACCTCCAAGACCATCACCA
TCGAAATGCCTGAATGTTTCTTCACTGATGACCATGGACC
AATTCAGAAAGTCCAGGTCATAGTTTCTGAACCCGCAGTG
ATGGACTACGGTAATCTATCCAACTGGAAGAGTGTTTTCC
TCCACCCCACTGCTCCATACCTGACAGACGATGGCTTCCT
GAACCCAGAGTGCCCTAAAAATTCTGAGCGCATGAGCTCA
AGCACTAAGACGTATGTTATAGGAGAAGACGAGGGCTGCC
TGTCTGAAGATGCAGAGACGCTTTGTAACGGACCTCTGAA
ACCCAAAACACATTATGTGTTCAAATTTCGAGCGACAAAC
ATACGTGGCCAGTTCACAGACTCTGAGTACTCAGACAAAG
TCAGAACTGCAGATGACCGCTTGCTGACCAGAGATGAGCA
GATCATCCTTGGAGTCTTGCTGTCATTTTTTCTGGCGTTG
TTTTTAATTCTGATTATATATGGATCTGTGAAGATCCACC
GGAGGAAGAAGGAAGGAGGGACGTATTCGCCACGCCAAGC
CGAGATTATTGAGACCAAATTCAAGCTGGATCAGCTCATC
GCTGTGGCCGATCTGGAGCTCAAAGAGGAGAAGATTAATC
GGCTGCTAAGTTACAGGAAATCCCTCAAGCCAATCAGTAA
GAAATCGTTTCTTCAGCATGTGGAAGATCTTTGTGCCAAC
GACAACGCCAAGTTTCAGGAGGAGTTTGCTGAGTTGCCGA
AGCTGCTGCAGGATCTGGCCACATCAGACGCTGACCTGCC
TTGGAATCGCTCCAAAAATCGCTTCACAAACATCAAGCCC
TACAACAATAGCCGAGTGAAGTTGCTGTCTGAGCCAGGAA
TGCCGGGTTCTGACTACATCAATGCCAGCTTCGTCTCTGG
CTATCTGTGTCCTAATGAGTTTATAGCCACTCAGGGCCCT
CTGCCGAGCACCGTCGCAGATTTCTGGAGGATGATTTGGG
AAACTGGGACTAAAACCATCGTCATGCTTACTCAATGCTT
TGAGAAGGGCCGGATCCGCTGTCATCAGTACTGGCCGGAG
GACAATAAACCAGTCACTGTTTTTGCTGACATCATAATCA
CTAAACTCACAGAGGACGTGCGTCCTGATTGGACGGTGCG
GGCACTCAAAGTGGAGCGGCATGGCAGCTACATGATTGTC
CATCACTTTAACTACACCTCATGGCCAGAACACGGCGTTC
CCGAATCCAGCTCCACACTTGTCCAGTTTGTCAAAGCCGT
TCGCTCCAACAGAGGCCATGAAAACACTACCATCGTGGTC
CACTGCAGTGCTGGTGTGGGCAGGACTGGAGTGTTTATAG
CACTGGATCATCTCATCCAGCATTTGCGAGATCATGAATT
TGTTGACATATACGGCCTGGTCGCAGAGCTGCGCAGTGAG
AGGATGTGTATGGTGCAAAACCTGGCTCAATACATGTTTC
TCCATCAGAGCACTCTGGATCTGCTGTCGGCCAAAGGAAA
CAGTCAGTCCATATGGTTTGTCAATTACTCCGCTCTGGAG
AAGATGGACTCGCTGGATGCAATGGAGGGTGACGTTGAAT
TGGAGTGGGAAGAGACGACCATGTAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations