Transcript

ottdart00000001841

ID
ZDB-TSCRIPT-090929-23214
Name
ottdart00000001841
Previous Names
  • busm1-79f24.1-001
  • si:busm1-79f24.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
AB
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000001841 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000001841|OTTDARG00000001723|ZDB-GENE-040426-2713 spryd7a|OTTDARP00000001626 BUSM1-79F24.1-001 LG_ AL606727.3 Danio rerio protein_coding NOVEL, 1116 bp
ACGTCATATCCTGTTAGCTTAGCATCTAGATTCAATAAAA
ATGACCTCCGTTGGTTGATGGCTCGAATAGCCCCGTATGA
CAACTAAACTTGAGCGGAATCAAGTTATTTAACCGTAACA
GTGTTGCTGTGGGAAAAATAATATTATGGCAGCGCTGCTT
TCGTGCTGTTTTGGCTGCTGTGGAGACAATAACAGTGGCC
ACGTAACACTGAAGGAAATGCCCACGGTTCAGCTGGACAC
TCATCACATGGGTACTGATGTTGTCATTGTAAAGAGTGGA
AGACGCATATGTGGAACCGGAGGCTGTACAGCAAACGCTC
CTCTCCATCAAAACAAAAGCTACTTTGAATTCAAGATTCA
GTCTACAGGTGTCTGGGGAATAGGAGTGGCAACTCAGAAA
GCAAATCTAAACCAGATCCCTCTGGGTCGAGACCCGCACA
GCCTTGTGCTTCGGCAAGATGGCACCGTGTACCATAACAA
CGAAGAAAAGAACCGATTACCAGCTAACAGCTTGCCGCAG
GAAGGGGACATTGTGGGTGTTACATATGACCATGTGGAAC
TGAATTTGTACCTAAACGGGAAGAATATGAACTGTCCAGC
ATCAGGCATCAGAGGAACTGTTTATCCTGTAGTTTATGTG
GACGATAGTGCAATACTGGATTGTCAGTTCGGTGACTTCT
ACTATCCTCCTCCACAAGGCTACCAGAAGATTCTCTTCGA
GCAACAGATCTTTTAAAGTTCCCATTGTGCTGTTGCATAC
ACTAAACATACTCCACAGCCGGGATTTGAAGTGCTACGGT
TATGATTGATTCCTAACTATAGGGTGGCTCAGACTACTGA
AAGGAGTTGAGTCAAACGACAGATGGCCTTCTGCTTTTCA
TGTCAACTTGTGCGATTTCATCATCCTGCACACTTATTTG
TGCACTGATCTCAAAGTTTATTCAGCGCATTCATCTTTCT
TTTGCACTGTGATTTTACTTGTATATCAACATTGTACTGT
TGTGAATTTTTGGTTTGAATATGAAACGGGTATATATTGG
AGTCATAAATTACAGCTGACAATCATGACTGACACTTTAT
ACATTTCAAGTGATGCTGACTCAAAACAGTCAACAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations