Transcript

spryd7a-201

ID
ZDB-TSCRIPT-090929-16751
Name
spryd7a-201
Previous Names
  • dkey-7a20.6-001
  • spryd7a-001
  • ottdart00000036247
  • si:dkey-7a20.6-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036247 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036247|OTTDARG00000027082|ZDB-GENE-040426-2713 spryd7a|OTTDARP00000029089 DKEY-7A20.6-001 LG_ BX294379.5 Danio rerio protein_coding KNOWN, 1180 bp
ATCACGTCATATCCTGTTAGCTTAGCATCTAGATTCAATA
AAAATGACCTCCGTTGGTTGATGGCTCGAATAGCCCCGTA
TGACAACTAAACTTGAGCGGAATCAAGTTATTTAACCGTA
ACAGTGTTGCTGTGGGAAAAATAATATTATGGCAGCGCTG
CTTTCGTGCTGTTTTGGCTGCTGTGGAGACAATAACAGTG
GCCACGTAACACTGAAGGAAATGCCCACGGTTCAGCTGGA
CACTCATCACATGGGTACTGATGTTGTCATTGTAAAGAGT
GGAAGACGCATATGTGGAACCGGAGGCTGTACAGCAAACG
CTCCTCTCCATCAAAACAAAAGCTACTTTGAATTCAAGAT
TCAGTCTACAGGTGTCTGGGGAATAGGAGTGGCAACTCAG
AAAGCAAATCTAAACCAGATCCCTCTGGGTCGAGACCCGC
ACAGCCTTGTGCTTCGGCAAGATGGCACCGTGTACCATAA
CAACGAAGAAAAGAACCGATTACCAGCTAACAGCTTGCCG
CAGGAAGGGGACATTGTGGGTGTTACATATGACCATGTGG
AACTGAATTTGTACCTAAACGGGAAGAATATGAACTGTCC
AGCATCAGGCATCAGAGGAACTGTTTATCCTGTAGTTTAT
GTGGACGATAGTGCAATACTGGATTGTCAGTTCGGTGACT
TCTACTATCCTCCTCCACAAGGCTACCAGAAGATTCTCTT
CGAGCAACAGATCTTTTAAAGTTCCCATTGTGCTGTTGCA
TACACTAAACATACTCCACAGCCGGGATTTGAAGTGCTAC
GGTTATGATTGATTCCTAACTATAGGGTGGCTCAGACTAC
TGAAAGGAGTTGAGTCAAACGACAGATGGCCTTCTGCTTT
TCATGTCAACTTGTGCGATTTCATCATCCTGCACACTTAT
TTGTGCACTGATCTCAAAGTTTATTCAGCGCATTCATCTT
TCTTTTGCACTGTGATTTTACTTGTATATCAACATTGTAC
TGTTGTGAATTTTTGGTTTGAATATGAAACGGGTATATAT
TGGAGTCATAAATTACAGCTGACAATCATGACTGACACTT
TATACATTTCAAGTGATGCTGACTCAAAACAGTCAACACT
GCATCACTTTTTCTGTTTGATATATGACCCACACACTCCA
TACTTATTATCATAATCCGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations