header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-16751
Transcript Name: spryd7a-201
Previous Names: dkey-7a20.6-001, spryd7a-001, ottdart00000036247, si:dkey-7a20.6-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000036247 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000036247|OTTDARG00000027082|ZDB-GENE-040426-2713 spryd7a|OTTDARP00000029089 DKEY-7A20.6-001 LG_ BX294379.5 Danio rerio protein_coding KNOWN, 1180 bp
ATCACGTCATATCCTGTTAGCTTAGCATCTAGATTCAATA
AAAATGACCTCCGTTGGTTGATGGCTCGAATAGCCCCGTA
TGACAACTAAACTTGAGCGGAATCAAGTTATTTAACCGTA
ACAGTGTTGCTGTGGGAAAAATAATATTATGGCAGCGCTG
CTTTCGTGCTGTTTTGGCTGCTGTGGAGACAATAACAGTG
GCCACGTAACACTGAAGGAAATGCCCACGGTTCAGCTGGA
CACTCATCACATGGGTACTGATGTTGTCATTGTAAAGAGT
GGAAGACGCATATGTGGAACCGGAGGCTGTACAGCAAACG
CTCCTCTCCATCAAAACAAAAGCTACTTTGAATTCAAGAT
TCAGTCTACAGGTGTCTGGGGAATAGGAGTGGCAACTCAG
AAAGCAAATCTAAACCAGATCCCTCTGGGTCGAGACCCGC
ACAGCCTTGTGCTTCGGCAAGATGGCACCGTGTACCATAA
CAACGAAGAAAAGAACCGATTACCAGCTAACAGCTTGCCG
CAGGAAGGGGACATTGTGGGTGTTACATATGACCATGTGG
AACTGAATTTGTACCTAAACGGGAAGAATATGAACTGTCC
AGCATCAGGCATCAGAGGAACTGTTTATCCTGTAGTTTAT
GTGGACGATAGTGCAATACTGGATTGTCAGTTCGGTGACT
TCTACTATCCTCCTCCACAAGGCTACCAGAAGATTCTCTT
CGAGCAACAGATCTTTTAAAGTTCCCATTGTGCTGTTGCA
TACACTAAACATACTCCACAGCCGGGATTTGAAGTGCTAC
GGTTATGATTGATTCCTAACTATAGGGTGGCTCAGACTAC
TGAAAGGAGTTGAGTCAAACGACAGATGGCCTTCTGCTTT
TCATGTCAACTTGTGCGATTTCATCATCCTGCACACTTAT
TTGTGCACTGATCTCAAAGTTTATTCAGCGCATTCATCTT
TCTTTTGCACTGTGATTTTACTTGTATATCAACATTGTAC
TGTTGTGAATTTTTGGTTTGAATATGAAACGGGTATATAT
TGGAGTCATAAATTACAGCTGACAATCATGACTGACACTT
TATACATTTCAAGTGATGCTGACTCAAAACAGTCAACACT
GCATCACTTTTTCTGTTTGATATATGACCCACACACTCCA
TACTTATTATCATAATCCGT

spryd7a TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA ottdart00000001841 (1) 1116
ncRNA spryd7a-002 (1) 796
mRNA spryd7a-201 1180
 Withdrawn Transcriptsextinct
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
spryd7a-201 Contained in:
[BAC] DKEY-7A20 (1) (order this)

OTHER spryd7a-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000036247 (1)
  • Ensembl_Trans:ENSDART00000074514 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC046022 (1) 1230 bp
    GenBank:CT662713 (1) 920 bp
    GenBank:EH440578 (1) 913 bp
    GenBank:DV585508 (1) 778 bp
    CITATIONS (2)