header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-16752
Transcript Name: spryd7a-002
Previous Name: si:dkey-7a20.6-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000036248 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000036248|OTTDARG00000027082|ZDB-GENE-040426-2713 spryd7a|no_translation DKEY-7A20.6-002 LG_ BX294379.5 Danio rerio protein_coding KNOWN, 796 bp
AAAATGACCTCCGTTGGTTGATGGCTCGAATAGCCCCGTA
TGACAACTAAACTTGAGCGGAATCAAGTTATTTAACCGTA
ACAGTGTTGCTGTGGGAAAAATAATATTATGGCAGCGCTG
CTTTCGTGCTGTTTTGGCTGCTGTGGAGACAATAACAGTG
GCCACGTAACACTGAAGGAAATGCCCACGGTTCAGCTGGA
CACTCATCACATGGGTACTGATGTTGTCATTGTAAAGAGT
GGAAGACGCATATGTGGAACCGGAGGCTGTACAGCAAACG
CTCCTCTCCATCAAAACAAAAGCTACTTTGAATTCAAGAT
TCAGTCTACAGGTGTCTGGGGAATAGGAGTGGCAACTCAG
AAAGCAAATCTAAACCAGATCCCTCTGGGTCGAGACCCGC
ACAGCCTTGTGCTTCGGCAAGATGGCACCGTGTACCATAA
CAACGAAGAAAAGAACCGATTACCAGCTAACAGCTTGCCG
CAGGAAGGGGACATTGTGGTGAGTCTTATAGGGATAGTGC
ATCCAAAAATGAAGCCCTCAGGCCTTTTAAGATGCAGATG
ACCAGGTAGAGAAGTAAAAAAAAAAAAAATCGAACGAGTT
GTCTCCTGGTATCTATATAATGGCGATTCATGGATGCTAT
CCAGACATCTCCTAGTTTTTCACGGTTCTGATGAAGGAAG
GAATTCTGAGGAATCCAACGCTAAATCAACAAAAAGTCCC
AATGTTTTTAAGACCCTGCAAAATTCCTAATTTAATTGCA
AAATAATCACAAATAATCTCATAAAACATCCAATTC

spryd7a TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA ottdart00000001841 (1) 1116
ncRNA spryd7a-002 796
mRNA spryd7a-201 (1) 1180
 Withdrawn Transcriptsextinct
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
spryd7a-002 Contained in:
[BAC] DKEY-7A20 (1) (order this)

OTHER spryd7a-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000036248 (1)
  • Ensembl_Trans:ENSDART00000144844 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CK239494 (1) 795 bp
    CITATIONS (2)