Transcript

spryd7a-002

ID
ZDB-TSCRIPT-090929-16752
Name
spryd7a-002
Previous Names
  • si:dkey-7a20.6-002
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036248 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036248|OTTDARG00000027082|ZDB-GENE-040426-2713 spryd7a|no_translation DKEY-7A20.6-002 LG_ BX294379.5 Danio rerio protein_coding KNOWN, 796 bp
AAAATGACCTCCGTTGGTTGATGGCTCGAATAGCCCCGTA
TGACAACTAAACTTGAGCGGAATCAAGTTATTTAACCGTA
ACAGTGTTGCTGTGGGAAAAATAATATTATGGCAGCGCTG
CTTTCGTGCTGTTTTGGCTGCTGTGGAGACAATAACAGTG
GCCACGTAACACTGAAGGAAATGCCCACGGTTCAGCTGGA
CACTCATCACATGGGTACTGATGTTGTCATTGTAAAGAGT
GGAAGACGCATATGTGGAACCGGAGGCTGTACAGCAAACG
CTCCTCTCCATCAAAACAAAAGCTACTTTGAATTCAAGAT
TCAGTCTACAGGTGTCTGGGGAATAGGAGTGGCAACTCAG
AAAGCAAATCTAAACCAGATCCCTCTGGGTCGAGACCCGC
ACAGCCTTGTGCTTCGGCAAGATGGCACCGTGTACCATAA
CAACGAAGAAAAGAACCGATTACCAGCTAACAGCTTGCCG
CAGGAAGGGGACATTGTGGTGAGTCTTATAGGGATAGTGC
ATCCAAAAATGAAGCCCTCAGGCCTTTTAAGATGCAGATG
ACCAGGTAGAGAAGTAAAAAAAAAAAAAATCGAACGAGTT
GTCTCCTGGTATCTATATAATGGCGATTCATGGATGCTAT
CCAGACATCTCCTAGTTTTTCACGGTTCTGATGAAGGAAG
GAATTCTGAGGAATCCAACGCTAAATCAACAAAAAGTCCC
AATGTTTTTAAGACCCTGCAAAATTCCTAATTTAATTGCA
AAATAATCACAAATAATCTCATAAAACATCCAATTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations