header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-23124
Transcript Name: ottdart00000001376
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: AB
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000001376 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000001376|OTTDARG00000001276|ZDB-GENE-980526-501 tal1|OTTDARP00000001214 tal1-001 LG_ AL592495.1 Danio rerio protein_coding KNOWN, 2510 bp
TTGTACATTTTCTGGGATCGCGCCGAAGGATGATGGAAAA
ACTGAAATCCGAGCAATTTCCGCTGAGCCCGAGCACGGAG
GGCTGCACATCTCCCCCGCGCGGGGATGGAGACGCGCGCG
GGAAACAGGAAGGCACGACGGCGGAGACAGGAGAGCATCG
CCTCCCTGAGGAGCTCAATGGTGTTGCCAAGGAAACGGCT
CACCACGCCACCGAGCTAAAAAAGGAGGTGGCGGTGATCG
AGCTGTCCAGGAGAGGAGGGAGCGCGGATATAAAAGGCAG
GGAGCTCAAGGCAGAACTCAGCCATAAGGTGCAGACCACC
GAGCTGTGCAGACCCCCGATTCCCTTGCCACTGCCTCCCA
GAGACCCGCTGAGCGACACTCGAATGGTGCAGTTGAGTCC
GCCCGCTTTCCCTCTCCCGGCACGAGCGATGCTCTACAGC
AACATGACGACGCCGCTCGCCACTATTAACAGTGGTTTTG
CTGGAGATGCGGAACAGTATGGGATGTATCCTAGCAATCG
AGTCAAGCGCAGACCTGCACCTTATGAGGTTGAAATCAAC
GATGGTTCGCAGCCCAAAATTGTGCGACGGATTTTCACGA
ACAGTCGCGAGCGCTGGCGACAGCAGAATGTGAACGGTGC
CTTCGCAGAGCTGCGCAAGCTCATCCCAACACACCCTCCT
GACAAGAAACTCAGCAAGAACGAGATCCTGCGTCTGGCCA
TGAAGTACATCAACTTTCTGGCTAAGCTCCTCAACGACCA
GGACGACATGGTCGGCGGTGAAGCTCCCGCCCGGGCCAAT
CGGGATAGCAGAGATGCAACTCTAGTGCGGGACGACCTCC
TTCAGGAGATGCTAAGCCCCAACTCCAGCTGCGGGAGTCT
GCTGGATGGGGACGCCAGCCCAGAGAGCTTTACTGAGGAC
CAGGACTCATCAGTGGAGTCCAGGCCCTCTGCAAGAGGAC
TACACCATTCCAGCCTACCGCTGGACGGAAATGCCCAGCG
GTGACTGATTGGAGACACTGACAGACTAATTTCTCGGGCT
GACAACTAGCGTATGTTCATGTTGTGTGCAAGCATATTCT
TACGTAAGACTTTCTGTTAACGCCCTCCGTGGAGAAACAC
TGGTACGGAGGAAGACCACCAGGTAGATTTTTAATCCACA
CTCCACAGGATCGCCACCTGAAAACGAAAACAAGCAGAGT
GAATGGTACCCACGCCTCATCAGGTACACTGACGGTATGG
AGGTCAGCCGGACTTTAGCGACAAAAATGAGCATTTGAAG
CAAGAAAGTCCAAGAAATGAAGTAGTTCACAGCAAATTGC
CATCATTTAAGCATCTTCATGTCACTCTAAACCACAGGTG
TCAAAGCCAGTTCATAGAGGGTCACAGCTCGGCACAGTTT
AGTTCCAACTTTGCTTCAACATACTTACCTGTAGGTTTTA
AACAAGCCTGAAAGACTCAATTAGTTTGATCACGTGTGTT
TAATTAGGGTTGAAACTAAACTGTGCAGAGCTGCGGCCCT
CCAGGAACTGGCTTTGACTGTGAAACCAATGCAATCCTAT
GGAAATTCGTAACTTTTTGATATAGTGTCTAATTCATATT
CATTTGTGCAGTCTCGTTCCTACATTTTAGTATGATTTGC
TCATCCTCCAATGAGGAGCAGGGCTAAAGTTGGGGTGAGG
GAGCACATTTTTTTTTACATTTGTATGTTTTCATACAAAT
ACAATGCGTAAAATAGTTACGTTTCCTTGTGAGATAGGGC
TGCTGAATCCCAAAAGACGCATAATTGAAAACCCATACAA
TGGAAGTTTAATAGAGGTATAACTCTTGGGATTTCATTGA
CTGGGCATTTTCGGAGAAGGTAGAAAATCGTACATCTGAA
GTGACATGACTGTGAATAAATGATGGCGCAGCTCAACGTC
TTTAAGACAAATTTGTACATACTGGAAATTCAAGTGGGTT
ATGACCTTTAAGTATTCTTAGCGGCATCTGGGGAGAAAAG
TATGGCCATTTTGTAAATGGTTTTTTCAGTATTATGTTTG
GATTACAAGTTTGGATGGTGGAGGAGGTACAGGAACGTGT
ACATAAACCAGGATAATGTTGTGCGTCTATAACGATGACC
CTTTAGACTGTTCTTTTGCATTGTGATCATGGTACACCAT
TAATTCGCATCTCCATTTTCCTATCACTCATTCGTTAGTT
TCTTTGCCCCCTCCAAGCCAAGCATCCCGCAACGACGAAT
CCATTGAGTAAATGTTCTGTCACTTTATTTGACTCGTATG
AACTTGATCTGCTTTTTAGCAGAGGATTGAGTAACCAGTC
TTGGTACCTTTAAGTCTTTTATTGGGTATTAAATGCGCAA
ACAAACAAACAAACATGGTTATTTTAATGTGATATCTAGT
AGAAAGACCTTTGTTGTAAGGTGAAACTCTATCTATGAAT
ATATGCAATGTTATATCTCACAAATTTTATATGAAAAGCC
CACAAAAATAAAAAAACACAAAGCCGAATG

tal1 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA ottdart00000001376 2510
tal1-201 (1) 2643
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ottdart00000001376 Contained in:

OTHER ottdart00000001376 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000001376 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AF045432 (1) 2873 bp
    GenBank:AF038873 (1) 2527 bp
    GenBank:BQ419178 (1) 657 bp
    GenBank:AI959346 (1) 489 bp
    CITATIONS (1)