header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-2012
Transcript Name: tal1-201
Previous Names: tal1-001, ottdart00000011548

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000011548 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000011548|OTTDARG00000010062|ZDB-GENE-980526-501 tal1|OTTDARP00000009955 tal1-001 LG_none BX664601.7,BX322568.13 Danio rerio protein_coding KNOWN, 2643 bp
AGTGCATCTAAAACCTCAGACATGGATGACCCTCCACAAA
ATGGCTCCATGCACACACTAACATCCACCGCCCGACGACG
GTGACCTCGGATGAGAAGCTAAACCGGGATTTACAACTTG
ATTTGGATACCACTTTGTACATTTTCTGGGATCGCGCCGA
AGGATGATGGAAAAACTGAAATCCGAGCAATTTCCGCTGA
GCCCGAGTGCGGAGGGCTGCGCTTCTCCCCCACGCGGGGA
TGGAGACGCGCGCGGGAAACAGGAAGGCACGACGGCGGAG
ACAGGAGAGCATCGCCTCCCCGAGGAGCTCAATGGTGTTG
CCAAGGAAACGGCTCACCACGCCACCGAGCTAAAAAAGGA
GGTGGCGGTGATCGAGCTGTCCAGGAGAGGAGGGAGCGCG
GATATAAAAGGCAGGGAGCTCAAGGCAGAACTCAGCCATA
AGGTGCAGACCACCGAGCTGTGCAGACCCCCGATTCCCTT
GCCACTGCCTCCCAGAGACCCGCTGAGCGACACTCGAATG
GTGCAGTTGAGTCCGCCCGCTTTCCCTCTCCCGGCACGAG
CGATGCTCTACAGCAACATGACGACGCCGCTCGCCACTAT
TAACAGTGGTTTTGCTGGAGATGCGGAACAGTATGGGATG
TATCCTAGCAATCGAGTCAAGCGCAGACCTGCACCTTATG
AGGTTGAAATCAACGATGGTTCGCAGCCCAAAATTGTGCG
ACGGATTTTCACGAACAGTCGCGAGCGCTGGCGACAGCAG
AATGTGAACGGTGCCTTCGCAGAGCTGCGCAAGCTCATCC
CAACACACCCTCCTGACAAGAAACTCAGCAAGAACGAGAT
CCTGCGTCTGGCCATGAAGTACATCAACTTTCTGGCTAAG
CTCCTCAACGACCAGGACGACATGGTCGGCGGTGAAGCTC
CCGCCCGGGCCAATCGGGACAGCAGAGATGCAACTCTAGT
GCGGGACGACCTCCTTCAGGAGATGCTAAGCCCCAACTCC
AGCTGCGGGAGTCTGCTGGATGGGGATGCCAGCCCAGAGA
GCTTTACTGAGGACCAGGACTCATCAGTGGAGTCCAGGCC
CTCTGCAAGAGGACTACACCATTCCAGCCTACCGCTGGAC
GGAAATGCCCAGCGGTGACTGATTGGAGACACTGACAGAC
TAATTTCTCGGGCTGACAACTAGCGTATGTTCATGTTGTG
TGCAAGCATATTCTTACGTAAGACTTTCTGTTAACGCCCT
CCGTGGAGAAACACTGGTACGGAGGAAGACCACCAGGTAG
ATTTTTAATCCACACTCCACAGGATCGCCACCTGAAAACG
AAAACAAGCAGAGTGAATGGTACCCACGCCTCATCAGGTA
CACTGACGGTATGGAGGTCAGCCGGACTTTAGCGACAAAA
ATGAGCATTTGAAGCAAGAAAGTCCAAAAAAAGGAGTAGT
TCACAGCAAAATGCCATCATTTAAGCATCTTCATGTCACT
CTAAACCACAGGTGTCAAAGCCAGTTCATAGAGGGTCACA
GCTCGGCACAGTTTAGTTCCAACTTTGCTTCAACACACTT
ACCTGTAGGTTTCAAACAAGCCTGAAAGACTCAATTAGTT
TGATCACGTGTGTTTAATTAAGGTTGAAACTAAACTGTGC
AGAGCTGCGGCCCTCCAGGAACTGGCTTTGACTGTGAAAC
CAATGCAATCCTATGGGAATTCGTAACTTTTTTATATAGT
GTCTAATTCATATTCATTTGTGCAGTCTCGTTCCTACATT
TTAGTATGATTTGCTCATCCTCCAATGAGGAGCAGGGCTA
AAGTTGGGGTTAGGGAGCACATTTTTTTTAAATTTGTATG
TTTCCATACAAATACAATGCGTAAAATAGTTAAATTTCCT
TGTGAGATAGGGCTGCTGAATCCCAAAAGACACATAATTG
AAAACCCATACAATGGAAGTTTAATAGAGGTATAACTCTT
GGGATTTCATTGACTGGGCATTTTCGTAGAAGGTAGAAAA
TCGTACATCTGAAGTGACATGACTGTGAATAAATGATGGC
GCAGCTCAACGTCTTTAAGACAAATTTGTACATACTGGAA
ATTCAAGTGGGTAATGACCTTTAAGTATTCTTGGCGGCAT
CTGGGGAGAAAAGTATGGCCATTTTGTAAATGGTTTTTTC
AGTATTATGTTTGGATTACAAGTTTGGATGGTGGAGGAGG
TACAGGAACGTGTACATAAACCAGGATAATGTTGTGCGTC
TATAACGATGACCCTTTAGACTGTTCTTTTGCATTGTGAT
CATGGTACACCATTAATTCGCATCTCCATTTTCCTATCAC
TCATTCGTTAGTTTCTTTGCCCCCTCCAAGCCAAGCATCC
CGCAACGACGAATCCATTGAGTAAATGTTCTGTCACTTTA
TTTGACTCGTATGAACTTGATCTGCTTTTTAGCAGAGGAT
TGAGTAACCAGTCTTGGTACCTTTAAGTCTTTTATTGGGT
ATTAAATGCGCAAACAAACAAACAAACATGGTTATTTTAA
TGTGATATCTAGTAGAAAGACCTTTGTTGTAAGGTGAAAC
TCTATCTATGAATATATGCAATGTTATATCTCACAAATTT
TATATGAAAAGCCCACAAAAATAAAAAAAAACACAAAGCC
AAA

tal1 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA ottdart00000001376 (1) 2510
tal1-201 2643
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
tal1-201 Contained in:

OTHER tal1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000011548 (1)
  • Ensembl_Trans:ENSDART00000083063 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AF045432 (1) 2873 bp
    GenBank:AF038873 (1) 2527 bp
    GenBank:CF266052 (1) 875 bp
    GenBank:CA470642 (1) 864 bp
    GenBank:CD753210 (1) 857 bp
    GenBank:CK362001 (1) 803 bp
    GenBank:BQ419178 (1) 657 bp
    GenBank:CK363085 (1) 646 bp
    GenBank:AI959346 (1) 489 bp
    GenBank:CD603509 (1) 469 bp
    CITATIONS (2)