ZFIN ID: ZDB-TSCRIPT-090929-23117
Transcript Name: hnrpkl-203
Previous Names: hnrpkl-001, ottdart00000040007

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000040007 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000040007|OTTDARG00000029201|ZDB-GENE-040426-1923 hnrpkl|OTTDARP00000031978 hnrpkl-001 LG_ CU468920.7 Danio rerio protein_coding KNOWN, 2288 bp
TGAAATCAAGACAGAAGGCGTAGAATTTTCGGGTGAAAAT
TGGTGTGACGGAAGGGCTGCCTGCAGAGTTACTCGTCGAG
GACAGCCTATTCCAGTTTCACGGCTGGCTGAAGACAATGG
AGACAGAAATTGAGCAGCAGGACGAAGATACCACTTTCAG
TAACACTGACACTAACGGCAAGCGCCCTGCTGAGGACATG
GATGAGGAACAGGCATTCAAACGCTCCCGCAATACAGATG
AAATGGTAGAACTCAGGGTGCTTCTCCAGAGCAAAAATGC
AGGGGCTGTGATTGGAAAGGGAGGCAAGAACATTAAAGCT
TTACGCACAGATTACAATGCCAGTGTATCAGTCCCAGACA
GCAGTGGCCCAGAGCGTATCCTGAGTGTGAGTGCAGATAT
AGACACCATTGGTGAAATTCTGCTGAAGATCATCCCGACT
CTGGAGGAGTATCAGCACTACAGCGGAACTGATTTTGACT
GTGAGCTGCGTCTGCTGATTCATCAGAGTCTGGCTGGAGG
CATTATTGGGGTCAAAGGTGCCAAAATCAAAGAACTGAGA
GAGAATACCCAGACTACAATCAAGCTTTTCCAGGAATGTT
GCCCCCACTCTACTGACCGAGTGGTGTTAGTTGGGGGTAA
ACCTGAACGTGTGGTTGAGTGCATCAAGGTCATTCTGGAG
CTGATTGCAGAGGCTCCCATTAAGGGTCGAGCCCAGCCTT
ATGATCCAAACTTTTATGATGAGACCTATGACTATGGTGG
ATTCACCATGATGTATGAGGAGAGAGGACGGCGACCTATG
GGTGGGTTCCCAATGAGAGGCAGAGGAGGATTTGATCGAA
TGCCTCCTGGTCGTGGCAGTCGGTCGGTCCCCCCTTCCAG
ACGTGATTATGATGATATGAGCCCACGCCGTGGACCACCT
CCACCACCACCCGGGAGAGGAGGACGTGGTGGCAGTAGGG
CCCGAAATTTGCCTCTGCCCCCACCACCGCCGCCTAGAGG
AGGTGATCGGTTTTCCCACCAGAGTTACCACAGCAATATG
GACGACAGACCAAATGACCGAAGGGGGCGGCCTGGAGATC
GCTATGAAAGCATGAGTGGAGGTGGATATGACAATAATTC
TTCTTGGGAGCCCTTCCAGTCTGGTGGTAGAGGTTCTTAC
AGCGACATCGGTGGGCCTGTCATTACAACACAAGTGACCA
TCCCTAAAGATCTGGCTGGCTCCATCATTGGGAAAGGCGG
ACAGAGGATCAAGCAGATTCGTCATGAGTCAGGAGCATCT
ATTAAAATCGATGAGCCTCTGGAGGGCTCAGAGGACAGGA
TCATTACCATCACAGGTACACAGGACCAGATTCAGAACGC
CCAGTATCTACTACAGAACAGCGTGAAGCAGTACTCTGGA
CGCTTCTTCTAGAGGATGGAGACTGAAGCCAAACTGCCAT
ACCCATTCACTTCAACTTGTTTTCAGAGCCTACATTCCTC
TGCTTCTTGGGTAGATGTGCTCCCTGCCATTTTCTCCTAA
CAATTTTTTTTTTGAAGCAACACATTTGAAAGAAAAGTTT
TTTTTTTCTGTTAAAAGCAAGTGGATCCTCTTTTTTTCCT
TTAACATTATCTTTCTGCACGCAAATGTTTTCCATTTATT
GATTGTACTGTTTGGTATATAGAGGGAGCCCATCTGTGAT
GTCCACTGTTGGCCTTACCAGAGCTGCATGCTAAGTCTGC
AACATGCAGAATGTCTTTTTTTTTTTTTTTATTTGGCCAA
TGAATTTGAATTGCCCCATTATCATCTTGACTTCATGATT
AGACGTTTGGGTGAAGTGTAAATACTGTTTTTTTTTATTT
TTTATTTTTTTTATTTAAAGGAAGAACATCTATTTTGATT
TGAAAAATGGGGCTATCGAGAATGAGCAAAAATTCATTCC
TGAGGGACTTTTTTTTTTCTTTCCTTTTTGTGCTGATTTT
TGTCAACCCGATTTCGAGATCAGTAAAATTTCAGGAGATG
AATGAACCGTTTGTACTCCATTGACATTGGGATCTATTAA
ATCTTGCTGGCGCTTCTTTTGTACGTCTGTTTGTAAGCAT
TTTTACCATTTTTAGATGGATCTTTCTAGATGCCTTCTCT
TCACAGTTGAGGGGAAATAATTTCTCTGTAAATTTAAAAA
AACTTGTGGCAGGTCTCTTCCATGTTTTCCTGTATCTTTT
TCTTTCTGTTCCCTCTGGTGTCTTTGTAGAATGTGCTGCA
AATCTAAAAAGTTAAATAAAAATAAAGTCTGTGCCACCTT
TTACTAAA

hnrpkl TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA hnrpkl-003 (1) 528
hnrpkl-004 (1) 711
mRNA hnrpkl-203 2288
aberrant processed transcript hnrpkl-204 (1) 1582
 Withdrawn Transcriptsextinct
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hnrpkl-203 Contained in:
OTHER hnrpkl-203 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000040007 (1)
  • Ensembl_Trans:ENSDART00000133156 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC096867 (1) 2290bp
    GenBank:CK017444 (1) 935bp
    CITATIONS (2)