ZFIN ID: ZDB-TSCRIPT-090929-20228
Transcript Name: hnrpkl-004
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000040010 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000040010|OTTDARG00000029201|ZDB-GENE-040426-1923 hnrpkl|no_translation hnrpkl-004 LG_ CU468920.7 Danio rerio protein_coding KNOWN, 711 bp
AATTGGTGTGACGGAAGGGCTGCCTGCAGAGTTACTCGTC
GAGGACAGCCTATTCCAGTTTCACGGCTGGCTGAAGACAA
TGGAGACAGAAATTGAGCAGCAGGACGAAGATACCACTTT
CAGTAACACTGACACTAACGGCAAGCGCCCTGCTGAGGAC
ATGGATGAGGAACAGGCATTCAAACGCTCCCGCAATACAG
ATGAAATGGTAGAACTCAGGGTGCTTCTCCAGAGCAAAAA
TGCAGGGGCTGTGATTGGAAAGGGAGGCAAGAACATTAAA
GCTTTACGCACAGATTATCCTGAGTGTGAGTGCAGATATA
GACACCATTGGTGAAATTCTGCTGAAGATCATCCCGACTC
TGGAGGAGGTAAGCAAATCAAATCACTTAAAGTTTCGCTT
GAATCAGGTGCATGAGGTTTTATCCATACCTGCTACCTTT
AAAGTCATTTATGCACAAGTCTACTGTCATTTAAGCATTA
CTATAAAATATAATATAAAGTAGACTTTTTTTTCCCCCCA
GAAATAATGTAGTCTTTATTAGAACTTTTGTAGTTGTAGC
TGTATCAAACTACTTAAAAAAAAAACTTTGTCTAAATCAA
ATGATCAAAATTAAATCATACATTTGTGAATGATACTTTT
GTAAACGATTTCAACTTAAGGAAGGATTAAAACAAAATGG
CGTTTTCAAAGGAAAAAGAAAAATTAAACAG

hnrpkl TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA hnrpkl-003 (1) 528
hnrpkl-004 711
mRNA hnrpkl-203 (1) 2288
aberrant processed transcript hnrpkl-204 (1) 1582
 Withdrawn Transcriptsextinct
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hnrpkl-004 Contained in:
OTHER hnrpkl-004 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000040010 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:DT877246 (1) 714bp
    CITATIONS (1)